Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer: Vacuole
Answer choices:
<span>Cell membrane
Mitochondrion
Nucleus
Vacuole</span>
Vacuoles<span> are membrane-bound structures found in both animal and plant cells. </span>
They have three important functions in plants -- provide support or rigidity, a storage for nutrients and waste matter until it can be removed, and decompose complex molecules.
Structurally
DNA and RNA<span> are nearly identical. As mentioned earlier, however, there are three fundamental </span>differences<span> that account for the very </span>different<span> functions of the </span>two<span> molecules. </span>RNA<span> has a ribose sugar instead of a deoxyribose sugar like </span>DNA.RNA<span> nucleotides have a uracil base instead of thymine.
</span>
p.s (google helped)
Answer:
recessive gene
Explanation:
mainly masked by thee dominant gene eg Tt where T is dominant over t,,,there t is recessive..
Answer:
a. All of the answers are correct.
Explanation:
During conjugation a bacteria transfers it's genetic material to another bacteria. The genetic material has genes in a particular order so we can easily know the order of the genes through experimentation. The transfer of genes occurs as per the time allowed. If two genes are nearby then they will be transferred one after the other.
For example in the given question, gene A was transferred to recipient bacteria in 26 minutes, gene M was transferred in 37 minutes while gene T was transferred in 45 minutes, it simply means that the order of genes is A M T. Gene M was transferred to another bacteria after A was transferred because time required to transfer it is 37 minutes which is less than time required to transfer A which is 26 minutes. Gene T took maximum time to get transferred so it will be last to be transferred.
After calculation, we can easily infer that the genetic distance between A and M is 11 minutes (37 minutes - 26 minutes = 11 minutes). Similarly we can get genetic distance between A and T as 19 minutes and between M and T as 8 minutes. So all the given options are correct.
