Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
So you need help? Mk....
Earth can be divided into three MAIN layers: the core, the mantle and the crust. Each of these layers can be further divided into two parts: the inner and outer core, the upper and lower mantle and the continental and oceanic crust. ... The inner core is solid, while the outer core is liquid.
Answer:
organisms have the amazing ability to make (produce) their own energy-rich food molecules from sunlight and simple chemicals.
Explanation:
Answer;
The above statement is false.
The ballistic method of developing flexibility is not the safest form of stretching.
Explanation;
-Ballistic stretching uses the momentum of a moving body or a limb in an attempt to force it beyond its normal range of motion. It involves stretching by bouncing into (or out of) a stretched position, using the stretched muscles as a spring which pulls you out of the stretched position. An example is the ballistic method of touching your toes would be to bounce and move toward your feet.