1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
astra-53 [7]
3 years ago
14

What would cause a person’s eye color to change from blue to green while that person was a child?

Biology
1 answer:
Degger [83]3 years ago
7 0

Answer:

Gray eyes may be called “blue” at first glance, but they tend to have flecks of gold and brown. And they may appear to “change color” from gray to blue to green depending on clothing, lighting, and mood (which may change the size of the pupil, compressing the colors of the iris

You might be interested in
About one in every 33 babies is born with a birth defect. Not all birth defects can be prevented, but a woman can take steps to
Pani-rosa [81]

Answer:

C

Explanation:

4 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Marking brainlist <br><br> What is the comparison of each of the layers of the earth?
Ludmilka [50]

Answer:

So you need help? Mk....

Earth can be divided into three MAIN layers: the core, the mantle and the crust. Each of these layers can be further divided into two parts: the inner and outer core, the upper and lower mantle and the continental and oceanic crust. ... The inner core is solid, while the outer core is liquid.

3 0
2 years ago
Read 2 more answers
Can organisms create their own energy? explain
My name is Ann [436]

Answer:

organisms have the amazing ability to make (produce) their own energy-rich food molecules from sunlight and simple chemicals.

Explanation:

5 0
2 years ago
The ballistic method of developing flexibility is the safest form of stretching. please select the best answer from the choices
Veseljchak [2.6K]

Answer;

The above statement is false.

The ballistic method of developing flexibility is not the safest form of stretching.

Explanation;

-Ballistic stretching uses the momentum of a moving body or a limb in an attempt to force it beyond its normal range of motion. It involves stretching by bouncing into (or out of) a stretched position, using the stretched muscles as a spring which pulls you out of the stretched position. An example is the ballistic method of touching your toes would be to bounce and move toward your feet.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Low calcium levels in the blood can be raised by dissolving bone tissue. Which cell would most likely be involved in this proces
    11·1 answer
  • Name the final form of chemical energy produced by cells during cellular respiration
    13·1 answer
  • Where does actual oxygen exchange take place in the human respiratory system? A. bronchi B. trachea C. diaphragm D. alveoli
    5·2 answers
  • A microbiologist observed the genetic sequence of DNA change from
    15·1 answer
  • Both whales and clown fish live in oceans. Whales are classified as mammals and clown fish are classified as fish. Which charact
    8·2 answers
  • What is the main function of the nucleus and why
    12·1 answer
  • What are the longest cells(when mature) in the human body?
    12·1 answer
  • How are DNA and RNA different
    12·1 answer
  • What kind of snake has got cylinder body and orange eyes?
    8·1 answer
  • For lunch, Dawn chose green salad, fruit salad, and minestrone soup. Her lunch is rich in which nutrient?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!