All categories

3 years ago

I only have two questions, thank you! One difference between a point mutation and a chromosomal mutation is that ____

2 answers:

5 0

For the first question the answer would be B.
For the second question the answer would be D. I am not 100% on this but its my best guess.

OlgaM077 [116]3 years ago

5 0

Answer:

1. The most appropriate answer would be an option C.

A point mutation refers to the mutation or change that occurs at only one or a few nucleotides of the DNA.

Usually, a single nucleotide is substituted with the wrong nucleotide due to which only a single codon is affected.

However, it can cause frame shift mutation if insertion or deletion of nucleotide takes place.

In contrast, in chromosomal mutation long segment of DNA is involved. It may involve one or more genes. It mainly includes insertion, deletion, translocation, and inversion.

In addition, chromosomal mutation can cause change in the number or sets of chromosomes such as poliploidy, aneoploidy et cetera

2. The correct answer would be C. A point mutation

A point mutation refers to the mutation or change that occurs at only one or a few nucleotides of the DNA.

You might be interested in

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago

In the process of fat hydrogenation, hydrogen atoms are added to which part of the molecule?

Murljashka [212]

B is the correct answer

6 0

3 years ago

What is a molecule????

Anettt [7]

Answer:

a group of atoms bonded together, representing the smallest fundamental unit of a chemical compound that can take part in a chemical reaction.

6 0

2 years ago

Suggest why captopril or other ACE inhibitors might fail to lower a patient's blood pressure?

rjkz [21]

Answer:

Angiotensin-converting enzyme (ACE) inhibitors are commonly prescribed to treat high blood pressure, heart problems and other conditions. Find out how they work and their possible side effects.

Angiotensin-converting enzyme (ACE) inhibitors help relax veins and arteries to reduce blood pressure. ACE inhibitors prevent an enzyme in your body from producing angiotensin II, a substance that narrows your blood vessels. This narrowing can cause high blood pressure and force the heart to work harder. Angiotensin II also releases hormones that raise blood pressure.

In addition to high blood pressure, angiotensin-converting enzyme inhibitors prevent, treat or improve symptoms in conditions such as the following:

Coronary artery disease

Heart failure

Diabetes

Certain chronic kidney diseases

Heart attacks

Scleroderma: a disease that involves hardening of the skin and connective tissues

Migraines

The doctor may prescribe other medications in addition to an angiotensin-converting enzyme inhibitor, such as a diuretic or a calcium antagonist. Angiotensin-converting enzyme inhibitors should not be taken together with angiotensin receptor blockers or with direct renin inhibitors.

Angiotensin-converting enzyme inhibitors work better for younger people than for older people. They also work better for white people than for black people. The doctor may recommend a different medication.

7 0

3 years ago

A different DNA ladder from NEB (Cat #N3200L) comes as 500 uL of a 1000 ug/mL solution and is not pre-mixed with the 6 X DNA loa

JulijaS [17]

Answer:

4 ul Loading Buffer + 19.70 ul dH2O + 0.30 ul DNA Ladder

Load 12 ul on the gel.

Explanation:

DNA Ladder concentration = 1000 ug/ml

1000 ug DNA in 1 ml DNA Ladder solution → 150 ng DNA = 0.15 ug DNA in..... 0.00015 ml = 0.15 ul DNA Ladder solution

6x DNA Loading Buffer → it has to be diluted by an equal volume 6 times (1 ul LB + 1 ul distilled H2O)

An appropriate volume to load on an average agarose gel is 12 ul, so:

2 ul Loading Buffer + 9.85 ul dH2O + 0.15 ul DNA Ladder = 12 ul

But since 0.15 ul is a very small volume and mistakes could be made while measuring it, let's make double:

4 ul Loading Buffer + 19.70 ul dH2O + 0.30 ul DNA Ladder = 24 ul

And load half of that solution (12 ul) on the gel.

5 0

3 years ago