1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DochEvi [55]
3 years ago
10

Is a relationship in which members of one species kills and eats members of another species.

Biology
1 answer:
SIZIF [17.4K]3 years ago
4 0

Answer:

Predation: An interaction in which one organism kills and feeds on another organism.

Explanation:

do u like dog the bounty hunter

You might be interested in
After duplication, at what point does a cell become two cells with identical DNA? starting in prophase end of anaphase end of cy
shepuryov [24]

Answer:

end of cytokinesis

Explanation:

Telophase is the last stage of cell division. It ends with cytokinesis which is the splitting of the mother cells into two daughter cells. The cell pinches in the equator region with the help of a ring of contractile protein filaments. The formed cleavage furrow grows until the two cells pinch off completely.  

8 0
3 years ago
Read 2 more answers
Which organisms perform cellular respiration?
adelina 88 [10]

Answer:

bacteria, archaea, plants, protists, animals, and fungi,

Explanation:

3 0
3 years ago
Water would be considered a ________.
Mamont248 [21]

Answer:

<em>Water would be considered a </em><u><em>actual renewable resource</em></u><em>.</em>

C. Actual renewable resource

3 0
3 years ago
Read 2 more answers
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Ribosomes are the site where
mezya [45]

Answer:

Ribosomes are the site where <em>proteins </em>are produced. Amino acids are coded for by triplet bases in RNA called <em>codons</em>. Hope this helps

6 0
2 years ago
Other questions:
  • Which of the following organelles are common in both prokaryotic and eukaryotic cells
    10·1 answer
  • What ions, ATP, and neurotransmitters are used in muscle contraction and where are they used??
    15·1 answer
  • Which process is responsible for the growth and repair of human tissue
    7·1 answer
  • What is an example of a genetically modified organism?
    15·1 answer
  • A geologist concludes that a rock sample is an extrusive igneous rock. Based on this information, which statement about the rock
    8·2 answers
  • You are an ecologist studying the life history of a newly discovered animal. You find that it reproduces slowly and has only one
    9·1 answer
  • Nutrients are transported to the organs of the bloodstream by which system
    5·1 answer
  • Describe the following interms of water cycle<br> (energy sources)<br> (carrier of nutrients)
    10·1 answer
  • Match the following vocabulary words with the correct definitions.
    15·1 answer
  • How would our interaction with the suns energy differ if our magnetosphere disappeared?​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!