75% (3/4)
there would be BB, Bb, Bb and bb
BB and Bb are the only ones that is dominant since bb is recessive.
The answer is "Groundwater"
The way that partially digested food leaves the body is through the pyloric sphincter.
<h3>What is digestion?</h3>
The term digestion has to do with the breaking down of complex food substances that is taken in by animals during nutrition. Food that is digested will go out of the body in semisolid form.
Hence, way that partially digested food leaves the body is through the pyloric sphincter.
Learn more about digestion:brainly.com/question/1283194
#SPJ4
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
