The average conversion energy from producers to primary consumers is _______.

2 answers:

6 0

The average conversion energy from producers to primary consumers is b. 10%. This percentage actually holds true for all transfer of energy at any trophic level in the food chain. Majority of the energy loss can be attributed to metabolic processes that give off heat and other forms of energy. It is important to note that energy cannot be created nor destroyed, it is simply transformed from one form to another.

faust18 [17]3 years ago

4 0

The correct answer would be B 10%

You might be interested in

Why is photosynthesis slower with underwater plants?

guajiro [1.7K]

Explanation: Photosynthesis is slower with underwater plants because carbon dioxide diffuse much more slowly in water than in air underwater leaves lack a waxy coating because carbon dioxide is easier to absorb without this layer.

8 0

3 years ago

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

torisob [31]

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

5 0

2 years ago

Translation is to protein as transcription is to blank

timama [110]

My guess would be mRNA or RNA but I'm not too sure about this question, sorry.

6 0

4 years ago

Which of the following are public health measures that have helped fight disease?

zubka84 [21]

The answer would be D all of the above

6 0

3 years ago

Read 2 more answers

Describe the role of cellular respiration in a plant???

Citrus2011 [14]

Answer:

The process of cellular respiration allows plants to break down glucose into ATP.

Explanation:

Although plants use photosynthesis to produce glucose, they use cellular respiration to release energy from the glucose.

5 0

3 years ago