1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivan
3 years ago
12

Why do we need cells to divide? Give two examples.

Chemistry
1 answer:
Alik [6]3 years ago
6 0

Answer:

Cells need to divide to reproduce.

Explanation:

They go through numerous stages, such as mitosis to further replicate themselves. They can't get things done alone, so they have to work in numbers.

You might be interested in
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
A gas is heated from 263.0 K to 298.0 K and the volume is increased from 24.0 liters to 35.0 liters by moving a large piston wit
Triss [41]

Answer:

The final pressure is approximately 0.78 atm

Explanation:

The original temperature of the gas, T₁ = 263.0 K

The final temperature of the gas, T₂ = 298.0 K

The original volume of the gas, V₁ = 24.0 liters

The final volume of the gas, V₂ = 35.0 liters

The original pressure of the gas, P₁ = 1.00 atm

Let P₂ represent the final pressure, we get;

\dfrac{P_1 \cdot V_1}{T_1} = \dfrac{P_2 \cdot V_2}{T_2}

P_2 = \dfrac{P_1 \cdot V_1 \cdot T_2}{T_1 \cdot V_2}

P_2 = \dfrac{1 \times 24.0 \times 298}{263.0 \times  35.0} = 0.776969038566

∴ The final pressure P₂ ≈ 0.78 atm.

4 0
3 years ago
What is a common land form that is formed when chemical weathering, specifically carbonation, is taking place?
Papessa [141]

Answer:

plateaus

Explanation:

7 0
3 years ago
Read 2 more answers
Air quality is a measure of how clean or polluted the air is. Which of the following is not a common way to determine air qualit
zhuklara [117]

Here we have to choose the way which is not the common way to judge the quality of the air in a particular area.

The measuring the amount of precipitation in the area is not the common way to determine air quality in an area.

The acidity of the rain causes due to the excess amount of CO₂ and SO₂ in an area. Both the gases cause pollution.

The measuring of the amount of a particular gas element is a renowned way to determine the pollution level of an area.

The ozone is a harmful gas so the measuring of  its amount in ground level can identify the level of pollution in the particular area.

8 0
3 years ago
The entire set of chemical reactions carried out by an organism make up the organism’s _____.
choli [55]

Metabolism is the entire set of chemical reactions carried out by and organism. 

Metabolism is the chemical process in your body to maintain life.  It transport substances from the food that you eat when digested into the different parts of the cells in your body.

3 0
3 years ago
Read 2 more answers
Other questions:
  • The student's lab manual says to mix 50 mL of his 2.0 M CaCl2 solution with 50 mL of a 3.0 M aqueous solution of sodium carbonat
    6·1 answer
  • how would you explain what happens to the particles during melting and dissolving to someone who is confused
    7·1 answer
  • Examine the statement and balanced equation.
    15·1 answer
  • What is the major cause of erosion and weathering that affects coastline features?
    6·1 answer
  •   plz  help need help fast
    13·1 answer
  • Consider this reaction:
    9·1 answer
  • 9. Which of the following concentrations has units of moles of solute per liter of solution?
    12·1 answer
  • 2.An atom with 35 mass number has 17
    6·1 answer
  • Calculate the freezing point (0°C) of a 0.05500 m aqueous solution of glucose.
    13·1 answer
  • What is the volume of an 2.3 m solution with 212 grams of calcium chloride (cacl2) dissolved in it?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!