1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Damm [24]
3 years ago
5

A- ESC NEO

Biology
1 answer:
Vanyuwa [196]3 years ago
3 0

Answer:

Earth takes in thermal energy from the Sun in a process called THERMAL RADIATION.

Sunlight strikes Earth's surface at different angles. This angle is called the angle of INCIDENCE.

Explanation:

It is thermal radiation because thermal radiation refer to process where electromagnetic waves are emitted from a body or matter whose temperature is higher than zero. The Earth take in thermal energy from the sun as a result of thermal radiation.

Angle of incidence is the angle between a ray of light and the surface of it's perpendicular direction. The sunlight strike the Earth surface at an angle called angle of incidence.

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
If the characteristic is eye color, what could be two different phenotypes?
Feliz [49]
The phenotype is just a characteristic/trait. 

For instance Brown and Green are phenotypes of eye color. 

This can also be used in Punnet Squares, and could be displayed as B and G. 
B equaling dominant Brown, and G = dominant Green, vice versa to g and b where they are recessive. 
7 0
3 years ago
Please someone help me and don’t send me a link
bezimeni [28]
1. Variations
2. Extinction
3. Behavioral
4. Functional
5. Structural
8 0
3 years ago
Which are specific to just prokaryotes, or just plants, or just animals?
serious [3.7K]
All cells have at least one strand of DNA. prokaryotic cells are single celled, plants have a cell wall and vacuoles, animal cells have a centrosome. smooth or: synthesize lipids, metabolized carbohydrates, store calciumrough or: has bound ribosomes, produces proteinsGolgi apparatus: flattened membrane sacs, modifies products of the ER manufacturers macromolecule sorts. lysosomes: membrane sac of hydrolytic enzymes, hydrolyzes proteins, mitochondria: power house of the cell, makes ATP and such chloroplasts: allows photosynthesis to be a thing
6 0
3 years ago
Which organelles are unique to plant cells?
gavmur [86]
2
hope i helped my dewd <3
8 0
3 years ago
Read 2 more answers
Other questions:
  • Use the numbers 1, 2, 3, 4, and 5 to place the protein creation steps below in the correct order. Ribosome attaches to the mRNA.
    9·2 answers
  • Many fad treatments for autism spectrum disorders make the parents feel good that they are trying something, but otherwise, they
    5·1 answer
  • A single gene mutation in cats can result in curly ears (see image). The cats are healthy and normal beyond the ear structure, w
    8·1 answer
  • The parasympathetic ganglion that serves the lacrimal gland and nasal mucosa is the ________. submandibular ganglion pterygopala
    14·2 answers
  • How is the carbon cycle related to global warming ?
    6·1 answer
  • The leave of a plant fold inward when it touched as a way to defend themselves from potential harm. What kind of response do the
    10·1 answer
  • 5 point
    13·1 answer
  • What methods are used in the industry to determine the presence of biomolecules in food.
    12·1 answer
  • Scientists looking at the fossil record observe that in a certain kind of spiny fish, the fish evolves to have a greater number
    5·2 answers
  • Explain how regulations related to hunting and fishing can impact biodiversity.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!