1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AlekseyPX
3 years ago
5

Using the information recorded by seismographs, scientists learned more about the depth and density of Earth’s layers.

Biology
1 answer:
mario62 [17]3 years ago
7 0
The correct answer would be TRUE
You might be interested in
TACATCCATCAGTTACGC A guanine replaced the 1st Thymine in the original DNA strand above, how many amino acids would be changed as
Julli [10]

Answer:

One amino acid

Explanation:

This question is describing the occurrence of the process of mutation, which is the alteration in the genetic sequence of a gene. In this question, a DNA sequence was given as follows: TAC-ATC-CAT-CAG-TTA-CGC. However, a SUBSTITUTION MUTATION took place in such a way that the thymine base was replaced by a guanine base to have mutated sequence: GAC-ATC-CAT-CAG-TTA-CGC.

Since the mutation is a kind of substitution mutation, only the codon affected by that mutation will change. This DNA sequence will be transcribed into a mRNA sequence. The mRNA will be read codon by codon (a group of hree nucleotides) to produce amino acid. Since one codon will be involved, one amino acid will be affected.

4 0
2 years ago
The electromagnetic waves with the highest frequencies are called:
Tasya [4]
The answer is b gamma
3 0
3 years ago
1. An organism's body is constructed using the information contained in memory b. proteins. Ribosomes. d. Deoxyribonucleic acid.
soldi70 [24.7K]

Answer:

Deoxyribonucleic

Explanation:

The carry traits from offspring parent.

7 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
What is the first way in which biology researchers present the results of their latest research?
Inga [223]
Generally people would say that the result are published in journals, and it is true that Journals are often the first opportunity for many people to read about those results.

However, it takes a long time to publish in a journal, and people often present their results to a smaller audience at a conference before the journal is ready.
8 0
3 years ago
Other questions:
  • sodium has an atomic number of 11 and has a net charge of 0. When sodium combines with chlorine, it has a net charge of +1. Why?
    6·2 answers
  • How do producers get the chemical energy they need to live and grow
    5·1 answer
  • The following template is used in a Sanger DNA sequencing experiment with dTTP, dCTP, dGTP, dATP and ddTTP. The primer is radioa
    6·1 answer
  • What is the most common plant
    10·1 answer
  • A new highly nutritious crop is going to be planted in an area where it has never been planted before. Which is the most likely
    15·2 answers
  • How can atmospheric nitrogen be converted to ammonium ions or nitrate ions?
    7·1 answer
  • Which of the following could be present in a prokaryotic cell?
    5·2 answers
  • 3. Explain the main difference between organisms of the
    12·1 answer
  • The image below represent a phase of mitosis which phase represented by the image
    11·1 answer
  • Albinism is caused by a recessive mutation. If two albino mice mate and produce offspring with normal pigmentation, what could y
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!