1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
steposvetlana [31]
3 years ago
7

Plants that have both imperfect male and imperfect female flowers on a single plant are called (blank).

Biology
1 answer:
nexus9112 [7]3 years ago
4 0
Plants having separate imperfect male and female flowers on one plant are referred to as "monoecious". When the flowers are on different plants the species is referred to as "dioecious".
You might be interested in
When __________ air masses move into an area they generally bring fair weather.
kakasveta [241]

Answer:

WHEN THIS AIR

Explanation:ansjn

MOVE into an area

7 0
3 years ago
Read 2 more answers
What two things can happen to pyruvic acid? Explain both
dalvyx [7]

Explanation:

Pyruvic acid supplies energy to living cells through the citric acid cycle (also known as the Krebs cycle) when oxygen is present (aerobic respiration), and alternatively ferments to produce lactic acid when oxygen is lacking (fermentation).Hope it helps

5 0
3 years ago
Which is not true of an introduced species?
cupoosta [38]
I believe the answer is A
8 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
In your own words, explain why the direction along which the electromagnetic wave travels is not the same as the direction along
Burka [1]
 i dont kno this one hasha
5 0
3 years ago
Read 2 more answers
Other questions:
  • Do the Three Energy Systems work independently of each other; or do they overlap with one another, each one contributing to diff
    12·1 answer
  • Which of the following about the ozone layer is not true? a. The ozone layer is formed in the stratosphere. b. The ozone layer h
    11·2 answers
  • Which option identifies the information that could best help the grower complete the estimate of harvest date in the following s
    10·1 answer
  • What is the difference between cells, tissues and organ?
    15·1 answer
  • PLEASE HELP ITS DUE NOW
    9·1 answer
  • What is el niño and how does it affect the climate​
    12·1 answer
  • What would the amino acid sequence be for the following piece of RNA: AUG–CGC–AUU–GAC–CAA?
    12·1 answer
  • Please please help hdjdjd question 9
    12·1 answer
  • Which organism would make a good bioindicator?
    15·2 answers
  • Describe the fate of pyruvate and nadh produced by glycolysis​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!