1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
3 years ago
15

You place a drop food coloring in a cup of cold water and another drop of food coloring in a cup of hot water.

Biology
1 answer:
Liono4ka [1.6K]3 years ago
3 0
It would mix faster in the hot water because it moves free and more faster with a bunch of water vapor coming off of it
You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
How do different cells in the body keep you alive?
Semmy [17]

Answer:

every cell in you body needs oxygen to help it metabolize it release from food for energy.cells that do the same job combines together to form body tissue such as muscles,skin bone tissue.cells can take in fuel.cells not only make up living things,they are living g things.

3 0
3 years ago
Which problem does the Montreal Protocol attempt to remedy?
madreJ [45]

Answer:

A.The hole in the ozone layer

Explanation:

• Montreal protocol is an international treaty that was signed to control the use of substances that are resulting in the depletion of the ozone hole.

This treaty was signed in the year 1987 and became effective form 1989.

• Since the time that this treaty has come into force, there has been a significant improvement in the ozone hole that was observed over Antarctic as it's size has decreased.

• This improvement has been possible because the treaty helped to phase out chemicals such as chlorofluorocarbons, carbon tetrachloride, etc. that are responsible for ozone hole depletion.

5 0
2 years ago
A passenger in a car is holding an open water bottle when the car stops suddenly. Why does the water in the bottle splash out wh
docker41 [41]

the force of bestop will fling you forward and the water will go to one side of the bottle and hit the side of the bottle and curved back up and come out because the force of

6 0
3 years ago
Read 2 more answers
The formation of new organisms is called _____.
Gwar [14]
The answer is A, reproduction.
7 0
3 years ago
Read 2 more answers
Other questions:
  • It is 10 a.m. and Julie is trying to decide what to prepare for tonight's dinner. She selects a frozen turkey breast and must th
    13·1 answer
  • How many different forms of lipids are commonly found in food?
    14·1 answer
  • Need help with this please...
    13·1 answer
  • A zebra cell is just about to replicate its DNA. Which of the following will happen first?
    13·2 answers
  • Which virus has a structure that includes an outer lipid bilayer that is studded with proteins?
    7·2 answers
  • Human sperm cells ________ than egg cells
    15·1 answer
  • 9. The drawings represent the particles in a sample of
    13·1 answer
  • Red-green colorblindness is an X-
    9·1 answer
  • On earth as a whole what happens to most of the precipitation?.
    5·1 answer
  • Which solution is most acidic?<br> A.pH=3<br> B.pH=7<br> C.pH=10<br> D.pH=14
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!