1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
2 years ago
11

Are my answers correct for Q1??

Biology
1 answer:
sertanlavr [38]2 years ago
7 0

You're correct.

Just make the last one OO

You might be interested in
Global phytoplankton levels
Brut [27]

Answer:

sry i still dont know

Explanation:

5 0
3 years ago
Energy is greatest when the most energy is stored?
taurus [48]
Yes I had this question in my chemistry class
5 0
2 years ago
What is the difference between a unicellular organism and a multicellular organism
VikaD [51]

Answer: A unicellular organism consists of 1 single egg, and a multicelluar organism consists of 2 or more eggs.

Explanation:

5 0
2 years ago
Which of the following describes Passive Transport? (for a cell)
Gnoma [55]

Answer:

The answer is D

Explanation:

5 0
3 years ago
Que contiene el condón?
victus00 [196]

Answer:

plss translate it in English so i Can easyly answer it.

Explanation:

Thank you.

7 0
2 years ago
Other questions:
  • Which type of fungi causes mold on bread?
    12·1 answer
  • Water that has been used, but is still able to be recycled, is called
    14·2 answers
  • what is the cellular process that begins with the breakdown of organic compounds (such as glucose) and continues with turning th
    6·1 answer
  • Responding to the environment by maintaining a stable internal environment despite changing external conditions is
    11·1 answer
  • Match the terms in the left column to near their definition on the right. Part Aa. Total peripheral resistance b. Blood pressure
    5·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Dance that provides honey bees information about both the direction and distance of food:
    9·1 answer
  • Explain the steps of crop production
    11·1 answer
  • ....... is the wall which separates right and left side of the heart .​
    8·2 answers
  • Cystitis is most often caused by Group of answer choices Escherichia coli. Leptospira interrogans. Candida albicans. Neisseria g
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!