1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yan [13]
3 years ago
6

The average temperature around the world has climbed due to global warning global warning has the greatest impact on which biome

. A)tundra b)desert c) tropical forest d) grassland
Biology
1 answer:
Gemiola [76]3 years ago
7 0

The answer is A) tundra.

You might be interested in
Why is The sun is the ultimate source of energy<br> for all living organisms.'
Bingel [31]
The answer is: The sun is called the ultimate source of energy because it is the source of almost all energies of the earth. Plants convert light energy from the sun into chemical energy (food) by the process of photosynthesis. Animals eat plants and use that same chemical energy for all their activities.
7 0
3 years ago
Read 2 more answers
I need an answer quickly
IgorLugansk [536]
Low pressure systems lead to rain
6 0
3 years ago
Read 2 more answers
Cellulose, chitin, and peptidoglycan function as structural molecules and withstand pulling and pushing forces well. Which struc
Sholpan [36]

Answer:

                                                                                   

Explanation:

4 0
3 years ago
Which lists three living units of the human body in order from the simplest to the most complex level of organization?
Umnica [9.8K]
Red blood cell, heart tissue, circulatory system
5 0
4 years ago
Read 2 more answers
The main excretory organs of insects and spiders are
Alex17521 [72]
<span>Malpighian</span>

These excretory organs are vital parts and accessories for the organism to survive and maintain homeostasis. Homeostasis is the process by which an organism maintains the internal environment of itself by obtaining nutrient, converting it into energy and excreting wastes.
7 0
4 years ago
Read 2 more answers
Other questions:
  • List 5 different limiting factors that may exist for sea otters
    13·1 answer
  • Using the model provided, which statement would not be correct regarding ATP
    9·1 answer
  • A student is examining a bacterium under the microscope. the
    13·1 answer
  • The first animal cloned by nuclear transfer was a _____ named Dolly.
    14·2 answers
  • In a cell with a high energy requiroment, which
    15·1 answer
  • What is the difference between a pupa and the adult stage of a butterfly?
    8·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • I need help as soon as possible​
    5·1 answer
  • Lactic acid is the by product of what energy system?.
    12·1 answer
  • 2. A hypothesis is an educated guess based upon observation. It is an
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!