1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulijaS [17]
2 years ago
9

Now consider a single base mutation in a codon for leucine that creates a codon for phenylalanine. A true reversion changes the

phenylalanine codon back to a codon for leucine. Which of the following leucine codon(s) could be mutated once to form a phenylalanine codon, and then mutated at a second site to restore a leucine codon?a. CUU
b. CUC
c. CUA
d. UUG
e. UUA
f. CUG
Biology
1 answer:
madam [21]2 years ago
7 0

Answer:

options A, B, D and E

Explanation:

leucine codons include: UUA, UUG, CUU, CUC, CUA, CUG

phenylalanine codons include: UUU, UUC.

<u>C</u>UU          

replace C with U to give

UU<u>U</u> phenylalanine codon

replace underlined with A

UUA leucine codon

<u>C</u>UC

replace underlined with U

UU<u>C</u> phenylalanine codon

replace underlined with A or G

UUA, UUG  leucine codons

UU<u>G</u>

replace underlined with U

<u>U</u>UU phenylalanine codons

replace underlined with C

CUU leucine codon

UU<u>A</u>

replace underlined with U or C

<u>U</u>UU or <u>U</u>UC phenylalanine codons

replace U with C

CUU or CUC leucine codons

You might be interested in
How does photosynthesis contribute towards maintaining a clean environment and ensuring food security?​
azamat

Answer:

Well for one photosynthesis gives out oxygen. This makes all animals able to live. So in that way it helps us and the world around us. Without photosynthesis we also could not eat food. No animals could live and no plants ould live. VERY IMPORTANT!

Explanation:

5 0
3 years ago
Describe the difference between rapid slow stable and negative population growth
Dovator [93]
rapid slow means walking
5 0
2 years ago
Peanuts seedlings were grown under identical conditions. What factor could account for differences in height among the seedlings
Scorpion4ik [409]
The position of the seedlings from the Sun and the gibberling
7 0
2 years ago
In pea plants, green peas is a dominant trait and yellow pea pods is recessive. A plant with green pods is crossed with a plant
klio [65]

Answer:

The genotype of each parent plant is 1:2:1

Explanation:

I don't say you have to mark my ans as brainliest but my friend don't forget to thank me if it has really helped you....

4 0
2 years ago
The process by which an adult organism arises is called
Artyom0805 [142]
It is called Maturation,  Development, and Growth
7 0
2 years ago
Other questions:
  • Angiotensin ii acts on the kidney to retain more sodium. <br> a. True <br> b. False
    14·1 answer
  • What will be the approximate volume when the temperature is at 900k
    12·1 answer
  • Why will a set of stars appear at a different angle to us at different times of the year?
    11·1 answer
  • How does an insect species become resistant to an insecticide?
    13·1 answer
  • 9)
    7·1 answer
  • What other body system plays a direct role in moving muscles?
    7·1 answer
  • Which of the following is NOT a type of carbohydrate? *<br> wax<br> sugar<br> starch<br> cellulose
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Plzzzzzzzzzzzzzzzzzzz help I am on a test
    11·1 answer
  • Which tides are the highest?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!