1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KIM [24]
3 years ago
12

Dichotomous Keys and branching diagrams organize different types of information about classification. how are these tools used d

ifferently?
Biology
2 answers:
Gennadij [26K]3 years ago
6 0

Answer:

In a dichotomous key you named then by their traits while in a branching diagram it already has the name and it's traits.

Explanation:

In dichotomous keys (also called single-entry or single-entry keys), a fixed sequence of alternatives must be followed, where multiple steps (including one or more characters) present two contrasting options (character states). As a result, only a single series of choices results in correct identification. Thus for each taxon there is a specific sequence of steps. An important factor of the dichotomous keys is that through them it is possible to name living beings through their characteristics.

A branch diagram can be used to represent a probability space. It can also be used to represent the various possibilities of a permutation or combination. This type of diagram provides a convenient way to organize information from a set of conditional events. In biology, the branch diagram shows the name and characteristics of a being and its relationship to different beings and characteristics.

Vadim26 [7]3 years ago
4 0
To show the different levels of classification and divide among species, and different organisms on planet Earth. It also creates a universal "language" for scientists around the world when referring to organisms (cougar & puma are the same animals; different name)
Example: The American Alligator and the Chinese Alligator (look it up!) are in the same family and genus, but are not the same species.
You might be interested in
What is Osmosis?........
jeka57 [31]
It is a part of the cell cycle.
4 0
3 years ago
Read 2 more answers
What does the citric acid cycle start and end with?
expeople1 [14]
The Krebs cycle<span> occurs right after glycolysis. The substance that begins the </span>Krebs cycle<span> is a 3-carbon molecule called pyruvic </span>acid<span>. The process breaks down the pyruvic </span>acid<span> into acetyl coenzyme A, releasing one of the carbon atoms into carbon dioxide.

hope it help</span>
3 0
3 years ago
When arterial blood pressure falls the body compensates to raise the blood pressure. Explain this process.
Aleksandr [31]

Answer:

the body distributes more blood to the body surface where it can ... Changes in diameter affect peripheral resistance, pressure, and flow, which ... the aorta and carotid arteries: The aortic sinuses are found in the walls of the ... When blood pressure drops too low, the rate of baroreceptor firing decreases.

Explanation:

7 0
3 years ago
The process by which an rna copy is made from dna.
Finger [1]
Transcription is the process<span> by which </span>DNA<span> is </span>copied<span> (transcribed) to mRNA, which carries the information needed for protein synthesis. Transcription takes place in two broad steps. First, pre-messenger </span>RNA<span> is </span>formed<span>, with the involvement of </span>RNA<span>polymerase enzymes.</span>
3 0
3 years ago
Read 2 more answers
Why do fuel prices increase
mel-nik [20]
It depends on where the fuel source is coming from and also how much fuel is there.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which equation has water as a product in the chemical reaction?
    6·1 answer
  • According to Moh's hardness scale, your fingernail would be rated as 2.5. Juan and Carol are trying to identify an unknown miner
    7·2 answers
  • Which statements regarding hypotheses are true
    14·1 answer
  • Identify the Allies’ purpose in invading Italy and France.
    15·2 answers
  • How did Wallace's ideas about evolution influence Darwin? ​
    11·1 answer
  • What 3 things do autotrophs<br> need for photosynthesis?
    15·2 answers
  • Indicate whether each of the following descriptions is true of microtubules (MT), microfilaments (MF), intermediate filaments (I
    12·1 answer
  • Can someone help me please ahhhh omggggg please please
    13·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • plzzz help i will give brainlyest Sally says that divergent plates cause the greatest, strongest Earthquakes. Marks says she's w
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!