1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stich3 [128]
3 years ago
5

Where does compression often occur?

Biology
1 answer:
vovikov84 [41]3 years ago
8 0

Answer:

Compression often occurs at a convergent boundary.

You might be interested in
Describe the biodiversity in the lion king movie
gizmo_the_mogwai [7]

Answer: never watched it

Explanation:

8 0
3 years ago
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
what would happen if a mutation caused a stop codon to appear too early in the mRNA strain being translated by the ribosome?
Mumz [18]
This will result in an incomplete amino acid that will cause the function of the protein to change and also the shape of the protein to change.  
4 0
3 years ago
hago una lista de al menos 8 ejemplos de cambios físicos de la materia que puedo observar en la vida cotodiana​
N76 [4]
Bbbhejdiwngnkwopqmciwllwo cove ennekwmcldow
3 0
4 years ago
Which of these best explains how solid waste can harm wildlife?
nydimaria [60]

Answer:

<u>Solid waste damps are seriously spoiling the environmental conditions in developing countries. An inefficient municipal solid waste management system may create serious negative environmental impacts like infectious diseases, land and water pollution, obstruction of drains and loss of biodiversity.</u>

Explanation:

i don't see any options!!

7 0
3 years ago
Other questions:
  • The study of which structure was instrumental in the formulation of the modern cell theory? plant cell animal cell cell membrane
    6·2 answers
  • The graph shows the changes in population of blackheads in rural michigan during a single year
    7·2 answers
  • If an animal does not consume glucose, how is the body still able to obtain the energy needed for cell processes.
    6·1 answer
  • What occurs during nondisjunction and the effect of the resulting cells
    8·1 answer
  • According to the cladogram, which organisms are the most primitive?
    9·1 answer
  • Three nucleotide bases in mRNA, that specifies (codes for) a particular amino acid is called a(n)
    11·1 answer
  • The creation of genetically identical offspring by a single parent, without the participation of sperm and egg, is called The cr
    10·1 answer
  • What states an advantage of sexual reproduction
    13·1 answer
  • Which types of organisms developed first due to the early environmental conditions<br> on Earth?
    5·2 answers
  • Dịch kẽ hay còn được gọi là dịch gì?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!