1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
3 years ago
8

How do hurricanes cause tornadoes?​

Biology
1 answer:
Zepler [3.9K]3 years ago
7 0

Answer:

This is called wind shear, and it can induce a spinning movement in the air. At first this creates a spinning cylinder of air that is parallel to the surface. But as with any thunderstorm, the convective cells in a hurricane create strong updrafts. These can tilt the spinning air upright; a tornado is born.

You might be interested in
How do natural disasters and human actions impact the environment? help ASAP
Phantasy [73]
When humans started industrialization we cleared land that once was habitats for other animals and global warming started when we started using all of those fossil fuels cause all that gas don't go nowhere and if a volcano erupt the lava can cover the whole island which will start the ecological succession or a thunder storm when lightning hit the ground it can cause a forest fire.
8 0
3 years ago
Read 2 more answers
Which combinations of traits would be possible in future generations if the genes for fur color and eye color assort independent
vovangra [49]

All four options:

black fur, black eyes

black fur, red eyes

white fur, black eyes

white fur, red eyes

Are correct! (Select all four)

3 0
3 years ago
A mechanism of Darwins proposed theory is
Alja [10]
Darwins proposed theory is the survival of the fittest.
7 0
3 years ago
During interphase, the cell must first
valkas [14]
C. Duplicate its genetic information
7 0
4 years ago
Organisms belonging to the same____would be the most closely related?
Zanzabum
Organisms belonging to the same faimly would be the most closley related.
8 0
4 years ago
Read 2 more answers
Other questions:
  • What is the first step of pregnancy
    7·2 answers
  • Portion of mutated hemogoblin dna
    12·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which carbohydrate can be used by the body as an immediate source of energy?
    12·1 answer
  • Which end of a water molecule has a negative charge?
    10·2 answers
  • 8. In the diagram below, which substance belongs in are: Z? Living Organisms include Chemical Compounds that can be Organic whic
    9·1 answer
  • Erin hears a rattling noise as she hikes through the desert. Her muscles tense and she breathes faster. According to Selye, Erin
    9·1 answer
  • Which DNA base is referred to as a wild card due to its ability to change into one of the other bases?
    7·2 answers
  • Will mark brainliest
    12·1 answer
  • 1.) There is a lot of carbon dioxide in the atmosphere, what is the process by which plants remove it from
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!