1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
murzikaleks [220]
2 years ago
9

Which is not a physical change in the digestive system?

Biology
1 answer:
bulgar [2K]2 years ago
6 0

Answer:

C

Explanation:

it is chemical, not physical

You might be interested in
The domain _____ contains all eukaryotic kingdoms
SIZIF [17.4K]
Should be Eukarya, I think
8 0
3 years ago
Sophie says dolphins and sharks look very similar so they must be related Jake disagrees says dna evidence has shown that the do
anyanavicka [17]

Answer:

Jake is correct.

Explanation:

Sophie is wrong because although dolphins and sharks can technically be said to be similar, it resulted from convergent evolution, which has nothing to do with common ancestry and rather to do with similar environments for their homes.

6 0
3 years ago
1.______ from the sun is transferred to_____ surface. some of that energy is then _____
Roman55 [17]

Answer:

This is going by the number of blanks there are from the beginning

1.Energy

2. Earths

3. Transferred

4.equator

5.sun

6.causes

7.effect

Please give me Brainliest!

4 0
3 years ago
Behavioral ecology is based on which premise?
Sloan [31]

Answer:

option c)

Explanation:

the correct option is option c)

behavioral ecology is the study of behavior of interaction of the individual with the different community or society.

behavioral ecology  study evolutionary behavior of species under ecological pressure.

if any organism has natural advantage in the ecosystem then natural selection favors them.

so, behavioral traits are subject to natural selection.

5 0
3 years ago
What is electrophoresis? Why does it allow scientists to separate pieces of DNA?
attashe74 [19]
Genetic fingerprinting – the analysis of DNA in order to identify the individual from which the DNA was taken to establish the genetic relatedness of individuals. It is now commonly used in forensic science (for example to identify someone from a blood sample) and to determine whether individuals of endangered species in captivity have been bred or captured from the wild. 
<span>•DNA sequencing – the determination of the precise sequence of nucleotides in a sample of DNA or even a whole genome e.g. the Human Genome Project. </span>

<span>The process of electrophoresis: </span>
<span>DNA is chopped, close to the VNTR regions, into fragments using restriction enzymes. The DNA fragments are placed on the agarose gel and a direct current is applied continuously to the gel. The DNA fragments are attracted to the anode. The shorter the fragment, the faster it moves. </span>
<span>The fragments are transferred onto an absorbent paper placed on top of the gel. The paper is heated to separate the 2 strands in each DNA molecule. Complementary probes which have a radioactive phosphorus isotope are and this pair up with the DNA strands. The paper is placed on an X-ray film and the film goes dark due to radiation emitted by the probes. Now we end up with a pattern of dark stripes on the film matching the positions reached by the fragments in the agarose gel.</span>
8 0
3 years ago
Other questions:
  • Explain why actively growing cells are usually small in size
    7·1 answer
  • "after 12 hours without eating, seth is very hungry. it is likely that seth's blood glucose level is _______________ and his blo
    5·1 answer
  • *I NEED A QUICK ANSWER*
    10·2 answers
  • What does organism mean
    9·1 answer
  • White best describes a theory
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Membrane proteins are among the most important proteins biologically because they allow the cells to communicate with their envi
    8·2 answers
  • When gametes are produced from a parent cell during normal meiosis, which of the following describes the number of chromosomes i
    7·1 answer
  • Although choanoflagellates are fundamentally unicellular organisms, they possess genes that code for cadherins and integrins. Wh
    6·2 answers
  • In general, which is the cause of a land breeze?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!