1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrei [34K]
3 years ago
6

1.______ from the sun is transferred to_____ surface. some of that energy is then _____

Biology
1 answer:
Roman55 [17]3 years ago
4 0

Answer:

This is going by the number of blanks there are from the beginning

1.Energy

2. Earths

3. Transferred

4.equator

5.sun

6.causes

7.effect

Please give me Brainliest!

You might be interested in
Most of the organisms grouped into which domain are known as extremophiles?
frutty [35]

Answer:

i pretty sure its c but i could be wrong

Explanation:

6 0
3 years ago
Read 2 more answers
Polysaccharide structure can be varied by differences in ________.
Scilla [17]

Answer:

monomers of MONOSACCHARIDES

Explanation:

Polysaccharides are large molecules formed from chains of POLYMERS linked together by glyosidic bonds. <u>MONOMERS are small sub units that formed polymers, they are therefore the building block of a polysaccharides.  The monomers of polysaccharides are called monosaccharid</u>es (1 sugar molecule.) when two of these are joined together they formed disaccharides (two sugars.)

Polysaccharides are fromed by joining  together condensation, (loss of water molecules,)  of mutiple monosaccharides units and the reversal of this to add water molecules to sepate them to monosaccharies is  sugar Hydrolysis.

Example of polysaccharides are starch, glycogen cellulose

Example of monosaccharides are glucose, galactose.

Disaccharides are common table sugar, sucrose, maltose, lactose  

7 0
3 years ago
An adult inhales about 6.0×10−4 m3 of fresh air during a breath. Only 20% of fresh air is oxygen. Assume the pressure in the lun
Luda [366]

the answer is D 2.9 X10^25

3 0
3 years ago
How was bacteria first discovered?
matrenka [14]

Bacteria were first observed by the Dutch microscopist Antonie van Leeuwenhoek in 1676

<u>-TheUnknownScientist</u>

3 0
3 years ago
Put the following actions in order: DNA replicates, cell grows, cell divides,
Mumz [18]

Answer:

cell grows, DNA replicates, cell prepares for mitosis, cell divides

3 0
2 years ago
Other questions:
  • Which two structures are not found in animal cells
    5·2 answers
  • Which term defines the ketotic state most individuals enter in the early morning even after eating a meal containing carbohydrat
    13·1 answer
  • Which carbohydrate is used for energy storage in the liver?
    12·1 answer
  • Why did the plant cell plasmolyze when immersed in a hypertonic solution?
    15·1 answer
  • What is the most important difference between vertebrates and invertebrates
    15·1 answer
  • What is the answer to this question,help please.
    10·2 answers
  • Which describes the genetic code in a human?
    6·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • True or False: Mass changes when gravitational force changes.<br> A<br> True<br> B<br> False
    11·2 answers
  • A viral outbreak in a city needs to be traced to its source. How can wastewater be used to trace the viral outbreak?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!