1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natulia [17]
2 years ago
10

Can anyone pls help me with this?!

Biology
1 answer:
ozzi2 years ago
7 0

Answer:

1/2

Explanation:

You might be interested in
If substances A and B are both in the solid phase and are at the same energy level, which of the two substances will need to hav
Keith_Richards [23]
Look at the photo for reference if you still need help unless you haven’t gotten it yet.

4 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
The hypothalamus communicates directly with which gland?.
Romashka [77]

The hypothalamus communicates directly with pituitary gland.

<h3>Hypothalamus?</h3>

Hypothalamus is a small part lied f the brain that is between the inferior and anterior of thalamus. This gland is linked up with the pituitary gland by the stalk-like infundibulum. The pituitary gland comprises of an anterior and posterior lobe and each love produce different hormones in response to signals from the hypothalamus.

posterior lobe contains the ends of nerve cells that is from hypothalamus. The hypothalamus transmitt the hormones directly to the posterior lobe via these nerves, and then the pituitary gland releases them.

Therefore, The hypothalamus communicates directly with pituitary gland.

Learn more about hypothalamus below.

brainly.com/question/1022285

5 0
2 years ago
Which of the following is used to determine the true color of a mineral?
zzz [600]
What are the following?
8 0
3 years ago
Sperm whales, a(n) species, maintain their populations close to carrying capacity.
soldier1979 [14.2K]
The answer is K-selected.

<span>The population size of K-selected species is fairly constant in time, unlike the population size of r-selected species. r-selected species are usually bellow carrying capacity and the population size is density independent. On the contrary, K-selected species are usually near or at carrying capacity and the population size is density dependent. It can be concluded that sperm whales have K-selected populations, since they </span><span>maintain their populations close to carrying capacity.</span>

4 0
3 years ago
Read 2 more answers
Other questions:
  • Can I get some help filling the blanks ?? Please?
    5·1 answer
  • Which trait would best indicate that a particular arthropod was a member of subphylum chelicerata?
    13·1 answer
  • What is a statement that can be proven by observation or measurement
    6·1 answer
  • In general which step ofvthe scientific method is generally follows a hypothesis​
    9·2 answers
  • What are some adaptations of flower petals to help attract pollinators
    11·2 answers
  • State one possible negative impact of importing a natural predator to control a pest
    14·1 answer
  • Complete the sentence. A good team member will actively listen, which means they will ______.
    10·2 answers
  • Who used a compound microscope to see chambers within cork amd named them cells
    12·2 answers
  • What is happening during the stage of meiosis shown below?
    13·1 answer
  • Which of the following best describes how amino acids affect the tertiary structure of a protein?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!