1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Whitepunk [10]
3 years ago
7

A cell moves particles from a region of lesser concentration to a region of greater

Biology
2 answers:
Morgarella [4.7K]3 years ago
5 0

Answer:

facilitated diffusion

Explanation:

Best if luck pal

Lapatulllka [165]3 years ago
4 0
1.) facilitated diffusion
You might be interested in
Which safe practice is part of using aseptic technique?using a safety shower to wash chemicals off skin and clothingwearing prot
Soloha48 [4]
It would be to wear protective clothing and gloves when transferring bacteria and fungi
3 0
3 years ago
Read 2 more answers
1. According to the graph below, what temperature will result in the highest rate of photosynthesis? A. 5°C
UNO [17]
<h3>✽ - - - - - - - - - - - - - - -  ~<u>Hello There</u>!~ - - - - - - - - - - - - - - - ✽</h3>

➷ It would be D. 25 degrees. This is because there was the highest oxygen  flow at this temperature meaning that the rate of photosynthesis was higher.

➶ Hope This Helps You!

➶ Good Luck (:

➶ Have A Great Day ^-^

↬ ʜᴀɴɴᴀʜ ♡

8 0
3 years ago
Read 2 more answers
How does weathering, deposition effect a hurricane
g100num [7]
Because the pressure of the rain is strong which affects the rain to become even stronger and forms a hurricane.
6 0
3 years ago
DNA is a nucleic acid involved in heredity, or the passing down of genetic traits from one generation to the next. DNA consists
Phoenix [80]

Nitrogenous base DNA consists of four unique nucleotides that each contain one unique nitrogenous base—adenine (A), thymine (T), cytosine (C), or guanine (G).

The specific arrangement of these four bases within the DNA of each organism gives that organism its unique traits; here are the arrangements:

-<u>Adenine</u> is paired with <u>Thymine</u> (think of A for apple and T for tree)

-<u>Cytosine</u> is paired with <u>Guanine</u> (think of C for car and G for garage)

search "DNA base pairs" and go to images for better understanding

5 0
3 years ago
What the heck is biology
inessss [21]

Answer:

Biology is the scientific study of life. It is a natural science with a broad scope but has several unifying themes that tie it together as a single, coherent field. For instance, all organisms are made up of cells that process hereditary information encoded in genes, which can be transmitted to future generations. Another major theme is evolution, which explains the unity and diversity of life.

Explanation:

Hope this helps

7 0
3 years ago
Other questions:
  • A female client with liver cirrhosis and chronic anemia is hospitalized for a deep venous thrombosis. The client is receiving a
    15·1 answer
  • Although many Yoruba dialects are spoken in Nigeria, the Yoruba belong to one
    11·1 answer
  • Describe how magma forms minerals by completing the flow chart below
    5·2 answers
  • In which phase of mitosis are the chromosomes lined up in the middle of the cell?
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Microcystis aeruginosis is a freshwater photosynthetic cyanobacterium. When temperatures increase and nutrients are readily avai
    5·1 answer
  • Hello please help i’ll give brainliest
    15·1 answer
  • Cuantos electrones se necesitan para formar una carga de-38 uC sabiendo que la carga de un solo electrón es -1.6x10-19 C​
    6·1 answer
  • What is the process of photosynthesis​
    12·2 answers
  • Why is it important to balance the rate of extraction of water from an aquifer with its rate of recharge?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!