Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Four cell processes that all living cells need energy for include:
Cell Division
Synthesis
Transport
Breakdown of Nutrients
Let me know if this helps!
Since an animal only becomes more complex, and not simpler, an ancestor to all organisms would have to be the most simple and primitive organism.
Answer:
i. (answer is in the file I attached)
ii. underground parts of the plants are thick , fleshy and swollen because they store food in the form of starch.
iii. Spines that have been converted into leaves. These prevent water loss by reducing surface area. The spines help defend the cacti from predatory animals. To decrease water loss due to evaporation, the cuticle is very thick and waxy.
iv. this plant is called a water lettuce it's leaves are modified to form modified to form hydrophyte They are aquatic plants that have evolved to thrive in water. This is capable of comprehending with aquatic macrophyte, which will be entirely submerged in water and in some circumstances allowed to float on the water's surface.
hope this helps :)
Answer:
Insulin helps the cells absorb glucose, reducing blood sugar and providing the cells with glucose for energy. When blood sugar levels are too low, the pancreas releases glucagon. Glucagon instructs the liver to release stored glucose, which causes blood sugar to rise.
Hope this helps!
