Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
16 genetically different offspring
Explanation:
This is the case as each parent has the ability to produce 4 uniquely different gametes through independent assortment. With such a scenario where each parent can product 4 uniquely different gametes multiplied by 4 parents, you have 16 offspring. So there's the possibility of producing 16 offspring that are unique.
Your body has many organs such as the heart and the lungs.
Explanation:
<u>F. Ribosome</u>
Around the endoplasmic reticulum, proteins are transported. The Endoplasmic Reticulum is a cytoplasmic membrane network. This continuous method not only raises the surface area within the cell but also conducts protein folding, synthesis, and transport.
Further Explanation:
Free ribosomes synthesize most proteins that operate in the cytosol (such as actin) or nucleus (such as DNA polymerase). Proteins that act within the endomembrane system (such as lysosomal enzymes) or those that are intended for cell secretion (such as insulin) are synthesized in the rough endoplasmic reticulum ER by bonded ribosomEs.
The rest of the ER that doesn't include ribosomes is called the smooth ER, and may contain lipids, enzymes, and other proteins. The first amino acids in the that polypeptide chain serve as a signal sequence as a protein bound for the endomembrane system is being synthesized by a ribosome. The signal sequence ensures that the ribosome binds to the ER's outer membrane and the protein gets into the ER lumen.
Learn more about cellular life at brainly.com/question/11259903
Learn more about mitochondria at brainly.com/question/8427362
Learn more about mitochondria and similar structures at brainly.com/question/2855039
#LearnWithBrainly
