1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
schepotkina [342]
2 years ago
14

Help me please :( ,Someone

Biology
1 answer:
Anna35 [415]2 years ago
8 0
Ammonia (NH3) is inorganic and would be the answer to your question
You might be interested in
What property of water explains why large bodies of water do not quickly fluctuate in temperature?
Olenka [21]
That is because water has a high heat capacity, meaning it can absorb large amounts of heat without the temperature being affected.
7 0
3 years ago
Read 2 more answers
Can someone please help me I’m stuck on this question!!
Lina20 [59]

Answer:I think that answer is b

Explanation:

4 0
3 years ago
1.) Why does menstruation begin?<br>2.) How long does the menstrual cycle usually last?<br>​
skelet666 [1.2K]

Answer:

1.) Why does menstruation begin?

A.) Period happens because of changes in hormones in the body. 

2.) How long does the menstrual cycle usually last?

A.) the menstrual cycle lasts 21 to 35 days while bleeding between 2 to 7 days

<u>-TheUnknownScientist</u>

8 0
3 years ago
How does energy acquisition in the deep sea differ from energy acquisition near the ocean’s surface?
hram777 [196]
I think the correct answer from the choices listed above is option C. The energy acquisition in the deep sea differ from energy acquisition near the ocean’s surface by the fact that o<span>rganisms in the deep sea do not have direct access to sunlight. Hope this answers the question. Have a nice day.</span>
7 0
3 years ago
Read 2 more answers
Placental 11β-hydroxysteroid dehydrogenase type 2 expression: correlations with birth weight and placental metal concentrations
Dafna11 [192]
The weight would be312
5 0
3 years ago
Other questions:
  • Reproduction, growth, renewal and repair are all reasons or __________in multicellula organisms
    14·1 answer
  • Determine which technological design criteria the tacoma narrows bridge did and did not meet. Explain your answer.
    13·3 answers
  • To have an impact on the evolution of a species what criteria does a behavior have to meet
    12·2 answers
  • PLEASE HELP WILL BRAINLIEST!!!
    5·2 answers
  • Why are autotrophs considered the basis of the food chain?
    11·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • An advantage of asexual reproduction is that it __________. Group of answer choices allows a species to easily rid itself of har
    8·1 answer
  • 18 POINTS!
    5·1 answer
  • The graph here shows a population of rabbits and an ecosystem that the rabbits are not allowed to enter or leave
    12·1 answer
  • ____________________ treatment is the oral administration of radioactive iodine to destroy thyroid cells.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!