Hey there!
Your answer is option B.
Alleles are two forms of single genes.
Hope this helps you.
Have a great day (:
Answer:
You haven't listed all the needed info
Explanation:
Let me know
Answer;
-The less dense, the more the ice will float, allowing animals to stay afloat and not in the water
Explanation;
-When water freezes, water molecules form a crystalline structure maintained by hydrogen bonding. Solid water, or ice, is less dense than liquid water. Ice is less dense than water because the orientation of hydrogen bonds causes molecules to push farther apart, which lowers the density.
-This means that ice floats on water and that lakes freeze from the top down to the bottom.This is vital for animals that live on ice, as their habitats would be greatly reduced or not exist at all if ice sank.
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
The biceps brachi (biceps) is a skeletal muscle
