1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aev [14]
3 years ago
11

Compare and contrast tidal volume (tv), inspiratory reserve volume (irv), expiratory reserve volume (erv), and vital capacity (v

c). why and how could an individual's tidal volume decrease and increase?
Biology
1 answer:
Phantasy [73]3 years ago
7 0
Tidal volume was the measure of air that regularly enters the lungs amid calm relaxing. The Expiratory Reserve volume was the measure of air you can powerfully breathe out pas an ordinary tidal termination. Then, the vital capacity was the measure of air a man can move into or lungs and is the entirety of the considerable number of volumes aside from leftover volume. Amid practice is the point at which the tidal volume could increment because of the additional carbon dioxide
You might be interested in
If a person with O blood type produces offspring with a person with B blood type, then what percentage of their offspring will b
vlada-n [284]

Answer

The correct answer would be B) 50 %.

In humans, the blood group is determined by three alleles I^{A},I^{B}, and i.

I^{A} and I^{B} are co-dominant whereas  i is recessive to other two.

Thus, the genotype of a person with blood group O would be ii.

The genotype of a person with blood group B would be either I^{B}I^{B} (homozygous condition) or I^{B}i (heterozygous condition).

The crosses are shown in the image below.

There is only one condition in which the person can have offspring with blood group O that is, when the other parent is I^{B}i.

In this condition, the probability of an offspring to have blood group O is 50%.

In other condition, the probability of an offspring to have blood O is 0%.


5 0
3 years ago
Read 2 more answers
Primary producers transform energy from sunlight and certain inorganic chemicals into ________.
iris [78.8K]
Plants and some bacteria use photosynthesis to produce simple sugars.
8 0
4 years ago
Select the choice that best completes the following sentence:
Tanzania [10]
The correct answer is C. air pressure
5 0
3 years ago
Mitosis results in the formation of how many cells
uysha [10]
Mitosis of a single cell results in two daughter cells
8 0
3 years ago
What should i name my parakeet? (its a make green one)
Anna [14]

Answer:

kiwi. :)

Explanation:

7 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Researchers determine that the biodiversity in a woodland region is declining. They identify two major threats to the region's b
    11·2 answers
  • The building blocks of proteins are __________ while the building blocks of nucleic acids are __________.
    12·1 answer
  • Condors are related to vultures and feed on carrion, or dead animals. A condor’s role in the food web is as a _____.
    15·2 answers
  • Which kind of wave would be observed in outer space between planets, where there is very little matter?
    13·2 answers
  • In 1 the options are
    8·1 answer
  • For a typical human aorta, the diameter of the lumen is 30 mm and the thickness of the wall is 4 mm. Assuming a blood density of
    5·1 answer
  • Which set parings correctly matches matches the process with its conditions
    6·1 answer
  • 6. What is the function of the vacuole in a cell?
    12·2 answers
  • The cell is most active mitotically in the g phase
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!