1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergey [27]
3 years ago
7

A science class breaks into four groups and tests the pH of the soil surrounding the school. Each group goes to an area that is

three meters squared (3m 2) in size and tests the soil four different times within that square. The data collected is then placed into a table for everyone to see as shown below.
Four students draw the following conclusions from the data:
Student 1: Group D’s data should be discarded because it is not similar enough to the other groups' data.
Student 2: There must be something near the parking lot that causes the pH of the soil to be higher and the class should design a new experiment to determine what it may be.
Student 3: There are definitely more magnesium ions in the soil near the parking lot, and that is why the pH of the soil is higher there.
Student 4: The pH of the soil in the ball field should be measured again because no two readings were identical.


Which student’s conclusion is scientifically valid based on the data in the table above?


A. Student 1


B. Student 2


C. Student 3


D. Student 4

Biology
2 answers:
yulyashka [42]3 years ago
8 0
Student 2 i think not sure
Brilliant_brown [7]3 years ago
4 0

Answer:Student 2

Explanation:

You might be interested in
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
2 years ago
During warm weather, what percentage of body water loss is seldom replaced even though an athlete drinks fluids?
Sloan [31]
Iddkdkdkdkdkdkdkdkdkdkdkkddkdkkdkdkdkdkdkdkdkd
3 0
3 years ago
Read 2 more answers
In a certain population of wolves, a mutation takes place and several wolves
Shalnov [3]
C... an animal that is faster than the others will have way better chances of survival. Thus, the animal with the mutation will pass on the trait more
7 0
2 years ago
What is a rock I need to know this fast
anyanavicka [17]
A mixture of minerals that makes up the earths crust.
8 0
3 years ago
Any point outside a contour line is a _____ elevation than the contour line.
bonufazy [111]
A<span>ny point outside a contour line is a lower elevation than the contour line.
</span>
7 0
3 years ago
Other questions:
  • The energy used for metabolic processes reduce the efficiency of secondary productivity
    12·2 answers
  • Is pain a sign or symptom
    6·1 answer
  • Why are fossil fuels considered a nonrenewable resource
    9·2 answers
  • What is the function of the Type II alveolar cell?
    14·1 answer
  • According to the modern theory of evolution, ...
    14·1 answer
  • 8. In chickens, brown feathers are dominant over red feathers. Suppose we cross two heterozygous chickens.
    8·1 answer
  • How do you know something is dead
    9·2 answers
  • What are the complimentary strands?
    5·1 answer
  • 5
    11·1 answer
  • a mechanism that is effective in maintaining a normal glomerular blood pressure only if the systemic mean arterial pressure rema
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!