1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alika [10]
2 years ago
13

Consider a major environmental change (like antibiotics entering a person's body). If there are not organisms in a population th

at have traits that allow them to still continue to survive to reproduce, what would likely happen to that population?
Biology
1 answer:
Olegator [25]2 years ago
8 0

Answer:

The population (of the bacteria) will reduce

Explanation:

This question appear a little confusing because of the structure of the second sentence. However, it appears to describe how an antibiotic works. Antibiotics work against bacteria by either making the environment toxic for the bacteria (which kills it) or inhibiting the growth/reproduction of the bacteria. Both patterns will eventually lead a sharp reduction in the population of the bacteria. Even if what the antibiotic does is to inhibit the reproduction of the bacteria, this act provides the body with an opportunity to fight the "unreproductive" remnants of bacteria thereby leading to the reduction of population of the bacteria.

You might be interested in
In the spotted tulip, white flowers are dominant to yellow (gene Y), and axial flowers are dominant terminal flowers (gene T). E
aleksklad [387]

Answer:

<em>9/16 A_B_ White colour, axial flower </em>

<em>3/16 A_bb White colour, terminal flower</em>

<em>3/16 aaB_ Yellow colour, axial flower</em>

<em>1/16 aabb Yellow colour, terminal flower</em>

Explanation:

Let the flower colour allele be represented by A and the flower position by B. The dominant white colour would be A while the alternate version (the yellow colour) would be a. Also, the dominant axial flower position would be B while the alternate terminal position would be b.

The Punnet's square result of crossing two plants that are heterozygous for both traits is as in the attached image.

AaBb   x   AaBb

Possible Offspring

<em>9/16 A_B_ White colour, axial flower </em>

<em>3/16 A_bb White colour, terminal flower</em>

<em>3/16 aaB_ Yellow colour, axial flower</em>

<em>1/16 aabb Yellow colour, terminal flower</em>

3 0
2 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Why is embryology considered evidence of evolution
suter [353]
The study of one type of evidence of evolution is called embryology, the study of embryos. An embryo is an unborn (or unhatched) animal or human young in its earliest phases. Embryos of many different kinds of animals: mammals, birds, reptiles, fish, etc. look very similar and it is often difficult to tell them apart.
8 0
3 years ago
The giant planets are made of "gases," ______, and ______.
Inga [223]

Answer:

I could be wrong but I believe it is,

"rocks," and "dark matter"

3 0
3 years ago
In garden peas, the axial (A) flower position is completely dominant to the terminal (a) flower position. You cross a true-breed
xxTIMURxx [149]

Answer:

AA

Explanation:

A true breeding organism for a particular trait is an organism that would produce progeny  with the same trait whe self fertilized.

Hence, since axial flower is represented by the allele A, a true breeding flowering plant will have the genotype AA.

Axial flower (A) is dominant over terminal flower (a).

True-breeding axial flowering plant will have the genotype AA.

True breeding terminal flowering plant will have the genotype aa.

AA is crossed with aa.

AA   x   aa

offspring: Aa, Aa, Aa and Aa.

All the offspring will exhibit axial flowering.

7 0
3 years ago
Other questions:
  • What circumstances are best for fossils to form? Select all that apply. Rapid burial absence or limited oxygen supply undistrube
    7·2 answers
  • __________ helps organisms transport nutrients.
    5·2 answers
  • How do chemicles cycle and energy flow?
    8·1 answer
  • Where do new genes come from
    10·2 answers
  • What types of molecules would be found inside a lysosome
    14·1 answer
  • Which is the biggest muscle in the human body?
    7·2 answers
  • List the types of catastrophic events that are most likely to impact our ecosystem here in Cypress, Texas. (that is where i my s
    8·2 answers
  • Excitatory stimuli generally cause the membrane potential of a neuron to
    5·1 answer
  • What are the defining characteristics of reptiles?
    6·2 answers
  • . certain varieties of chrysanthemums contain 18, 36, 54, 72, and 90 chromosomes; all are multiples of a basic set of nine chrom
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!