1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nana76 [90]
3 years ago
6

Which of the following elements is the most reactive?

Biology
2 answers:
saveliy_v [14]3 years ago
8 0

Answer: Option (d) is the correct answer.

Explanation:

It is known that reactivity of atoms increases on moving down the group. This is because on moving down the group there is also increase in number of shells.

As a result, outer shell electrons move away from the nucleus and thus force of attraction between the nucleus and electrons decreases.

Hence, it is easy to remove the electrons from outermost shell and thus reactivity of atom increases.

Therefore, we can conclude that the given elements are group 1 elements and largest of them is rubidium. Thus, out of the given options, rubidium element is the most reactive.

o-na [289]3 years ago
7 0

Rubidium


I am FLVS 8th grade to!

You might be interested in
PLEASE HELP (i will mark brainliest)
Amiraneli [1.4K]

Answer: Nonrenewable energy resources, like coal, nuclear, oil, and natural gas, are available in limited supplies. This is usually due to the long time it takes for them to be replenished. Renewable resources are replenished naturally and over relatively short periods of time. Renewable resources are resources that can be produced naturally and nonrenewable resources are resources that cannot be replaced. ... Things like fossil fuels, gas, oil and coal, we would use up those resources long before they could ever be replaced naturally.

Explanation: Yeah

7 0
2 years ago
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
In humans, free ear lobes are dominant over attached ear lobes. Two parents who are heterozygous are expecting a child.
garri49 [273]
75%. Yeah I think it’s 75%
7 0
3 years ago
The gram stain works because of differences in the ________ of bacteria.
erik [133]
Stomach that might be the right answer I think so.
5 0
4 years ago
The answer for the top one
ch4aika [34]

The answer is C.

Hope this helps :)

6 0
4 years ago
Other questions:
  • Investigate how changes in an ecosystem affect a food web.
    9·1 answer
  • The ecosystem boundary of a drainage basin can be defined by ________.
    7·1 answer
  • Attraction between a slightly positive hydrogen atom and a slightly negative atom often oxygen or nitrogen
    12·1 answer
  • Which of these is a non-seed vascular plant?
    14·1 answer
  • Which of these terms describe the movement of water through a cell membrane ?
    6·1 answer
  • What characteristic of viruses places it under the category of a "non-living" entity?
    15·1 answer
  • .) According to the video, how do they define a fossil?
    10·1 answer
  • How do analogous structures evolve?
    12·1 answer
  • The earth is sometimes described as a giant magnet. True or false?
    13·1 answer
  • When organisms leave the group they were born into and join another group, this can alter allele frequencies in the new group. W
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!