1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
13

Which contributes to Earth's ability to sustain life?

Biology
1 answer:
xeze [42]3 years ago
3 0

Answer:

D

Explanation:

This is because the atmosphere is refreshable and makes breathing so conducive.

You might be interested in
What are transparent worms that prey on other plankton?
TiliK225 [7]
<span><span>Chaetognaths worms </span>are the transparent worms that prey on the other plankton.
</span>
5 0
3 years ago
Lipids are important to living things for all of the following reasons, EXCEPT that they are
Strike441 [17]
ANSWER:

Needed to form cell membranes

I hope I was of help to you :)
6 0
3 years ago
How do you know that a cheek cell is an animal cell
Gre4nikov [31]
Well, do plants have cheeks? No! So it must be an animal cell!
3 0
3 years ago
Did he discover about magnetism in the oceans crust?
e-lub [12.9K]
The crust is not magnetic near the ocean ridges
5 0
2 years ago
Which level or organization is being affected in someone who has an Asthma attack?
Crank

Answer:

B tissue level

Explanation:

B tissue because whatever substance that got into the lungs will cause the tissue to swell up causing an asthma attack

7 0
3 years ago
Read 2 more answers
Other questions:
  • A client admitted with anorexia nervosa lost 30 lb (13.6 kg) during the previous 3 months. when planning this client's care, wha
    10·1 answer
  • How are meiosis and mitosis similar
    12·2 answers
  • 1) When biologists wish to study the internal ultrastructure of cells, they can achieve the finest resolution by using A) a phas
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Dna methylation is a mechanism used by eukaryotes to do what? see concept 18.2 ( page 368) hints dna methylation is a mechanism
    15·1 answer
  • A boatload of Swedish tourists, all of whom bear the MM blood group, is marooned on Haldane Island, where they are met by an equ
    8·1 answer
  • Science has limitation because
    7·1 answer
  • Which of the following regarding the Ames test is true?
    13·1 answer
  • 4. Which of the following does not make up a bronchi?
    8·1 answer
  • Which phase of cell division is shown?<br> O prophase<br> O anaphase<br> telophase<br> O metaphase
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!