1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANEK [815]
2 years ago
7

1. What type of chemical reaction is the following equation? AIBr3 +K → KBr + AI

Biology
2 answers:
AnnyKZ [126]2 years ago
3 0

Answer:

Single Displacement (Substitution)

Explanation:

Aluminum Bromide + Potassium = Potassium Bromide + Aluminum

Reactants:

Aluminum Bromide - AlBr3, Potassium - K

Products:

Potassium Bromide - KBr, Aluminum - Al

Dmitry [639]2 years ago
3 0

Answer:

<u>Single Displacement (Substitution)</u>

Explanation:

You might be interested in
What are three of the distinct stressful environmental conditions found in degraded areas in urban centers?
sdas [7]
There numerous of them but some of them would be contaminated soil which can be followed with altered soil chemistry that contains fewer soil organisms that are essential. The third one would be surface runoff due to extensively modified hydrology of the area.
3 0
3 years ago
Bacteria and other microbes can be used to "clean up" an oil spill by breaking down oil into carbon dioxide and water. Two sampl
aksik [14]

Answer:

For sample A, A=17.7 %, T=17.7 %, G=32.30%, C=32.30%

For sample B, A= 28.9%, T=28.9%, G= 21.10%, C= 21.10%

Explanation:

The composition of nitrogenous bases in DNA is calculated using the suggestions proposed by the results of the experiment performed by Erwin Chargaff.

He found that in a DNA sample the composition of purine to pyrimidine is 1:1. This indicates that the amount of purine equals pyrimidine. This can be presented as purines + pyrimidines= 100. Also, adenine binds thymine and cytosine binds guanine.

In the given question,  

<u>For sample A </u>

A= 17.7 %, Therefore, thymine will be = 17.7 %,

A+T= 35.40%

Now, G+C=100- 35.40%

G+C= 64.60%

content of G= 64.60/2= 32.30%

content of C= 32.30%

<u>For sample B </u>

T=28.9%, A will be= 28.9%

A+T= 57.80%

G+C=100-57.80%

G+C= 42.20%

Thus content of G will be= 42.20/2=21.10

content of C= 21.10%

Thus,  

For sample A, A=17.7 %, T=17.7 %, G=32.30%, C=32.30%

For sample B, A= 28.9%, T=28.9%, G= 21.10%, C= 21.10%

6 0
4 years ago
A fish feeds on algae in a pond. As a result, there is an energy transfer between trophic levels in the ecosystem. What is the n
kipiarov [429]
Cellular respiration
7 0
3 years ago
Read 2 more answers
What function do chloroplasts perform
Scilla [17]

Answer:

Chloroplasts absorb sunlight and use it in conjunction with water and carbon dioxide gas to produce food for the plant. Chloroplasts capture light energy from the sun to produce the free energy stored in ATP and NADPH through a process called photosynthesis.

Explanation:

8 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Other questions:
  • Two sets of data that show a relationship is an example of
    11·1 answer
  • What is the order of Mitosis?
    9·1 answer
  • What is the atomic number of an atom that has 6 protons 6 neutrons and 6 electrons
    9·2 answers
  • What is the form of a trait that seems to disappear in population
    7·1 answer
  • Why SA node called pacemaker of heart
    6·2 answers
  • After strenuous exercise a muscle cell would contain decreased amounts of
    10·1 answer
  • Which type of microscope can produce three-dimensional images of a cell’s surface?
    8·1 answer
  • Susan has just moved into a new house. For some reason, she cannot get the grass to grow in her yard. She decides to grow small
    6·1 answer
  • Why are kola nuts pink?
    11·2 answers
  • Why Ghana, Mali, and<br> Songhai rose and fell.<br> Please help me!!! I will mark
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!