Answer:
A.
Explanation:
Predators hunt prey. (Obviously). As such, they help control the population of that particular prey-species. If the predator species is removed from the equation, 2 times are changed. Long term & short term. Long term includes lower populations due to lack of resources. Short term includes overpopulation due to lack of threat.
Answer:
- Parental cross = Cch x chch
- F1 = 1/2 Cch (agouti coat); 1/2 chch (albino coat) >> 1:1 phenotypic ratio
Punnett square:
ch ch
C Cch Cch
ch chch chch
Explanation:
A heterozygous individual is an individual who has two different gene variants (i.e., alleles) at a particular <em>locus</em>. In this case, individuals having the "agouti coat" trait are heterozygous carrying both 'C' and 'ch' alleles. On the other hand, a homo-zygous individual has the same allele at a given <em>locus</em> (here, the 'chch' genotype associated with the albino phenotype). Therefore, as observed in the Punnett Square above, when a heterozygous parent is crossed with a homo-zygous recessive parent for a single gene, alleles segregate in the gametes of both parents so an expected 1:1 phenotypic ratio will be observed.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
An arrangement of genes consisting of an operator, a promoter, and a repressor is an OPERON.
