1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivahew [28]
3 years ago
15

Capital M = Melanin, darker skin color Capital N = No Melanin, lighter skin color Imagine the following couple; NN NN NN (female

) x NN MN NN (male) 13. Give the phenotypes for these parents. Female: lightest skin color Male: dark skin 14. a. What is the genotype of the darkest child they could have? b. What are the odds of producing such a child? Show your math: 14 - MNMNMN -middle brown skin 15. a. What is the genotype of the lightest child they could have? b. What are the odds of producing such a child? 16. What are the odds of having a child that is heterozygous for all three genes?​
Biology
1 answer:
Allushta [10]3 years ago
7 0
16. Is 50% I think because the teacher says that it’ll always be 50%
You might be interested in
Why do plants have a greater disadvantage in unpredictable environments than animals?
nirvana33 [79]
Well because animals can seek shelter and plants can't move at all.
6 0
3 years ago
Read 2 more answers
How does the structure of xylem relate to its function
denpristay [2]

Answer:

They lose their end walls so the xylem forms a continuous, hollow tube. They become strengthened by a substance called lignin . Lignin gives strength and support to the plant.

5 0
2 years ago
Tell whether the statement is TRUE or FALSE. When solving a system of linear equations, try to algebraically form one equation t
Kamila [148]
It is a true statement that when <span>solving a system of linear equations, try to algebraically form one equation that has only one variable. The correct option among the two options that are given in the question is the first option. I hope that this is the answer that has come to your desired help.</span>
7 0
3 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
A scientist is investigating the effects of electromagnetic radiation on plant growth. She wants to test the plants with two dif
Sladkaya [172]

Answer:

Explanation:c

3 0
3 years ago
Other questions:
  • The force of the Earth's gravity on an object gives the object its __________.
    5·2 answers
  • Jack Friedman, a 41-year-old male, was in a fight at a soccer game and was hit in the head with a bottle, which caused some deep
    6·1 answer
  • A scientist crossed a pea plant with a green pod and a pea plant with a yellow pod. The scientist collected 100 seeds from the c
    8·1 answer
  • Homeostasis depends on the activity of body systems to adjust a variable. Because our bodies work so well to maintain variables
    9·1 answer
  • Folded mountains form when two plates coverage and
    8·1 answer
  • What do animals ranging from corals to monkeys have in common? what do animals ranging from corals to monkeys have in common? so
    15·1 answer
  • What system contains transitional epithelium?
    8·2 answers
  • Give two function of the skull​
    12·2 answers
  • Calcitonin _________ osteoclast activity, which will _________ blood calcium levels.
    10·1 answer
  • How can you use word components to relate medical terms to the structure and function?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!