1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mario62 [17]
3 years ago
8

Which of the following best describes angiosperms?

Biology
1 answer:
Kaylis [27]3 years ago
5 0

Answer:

They produce seeds which are encased by an outer layer such as fruit.

You might be interested in
Function g can be thought of as a scaled version of f(x) = 2.
ddd [48]

Answer:

23

Explanation:

5 0
3 years ago
Helppppppppppppppppp plzzzzzzzzzzzzzzzzzzzzzzzz
Stella [2.4K]

Answer:

C could get brain list i will give you 50points

Explanation:

7 0
3 years ago
Describe the importance of biomes such as forests, freshwater, and marine biomes? How have human actions affected these biomes?
Allisa [31]

Forest biome:  It gives us medicinal plants, woods for commercial purpose. Forests provides us rubber and fibers that is very important for the industries for making various products. They also contribute to perform ecological  functions such as carbon storage, nutrient cycling, water and air purification. It also provides habitat to the wildlife.

Freshwater biome:  We use fresh water for drinking water, irrigation, sanitation systems, and in industrial factories. Water used from groundwater, rivers and lakes is regained by rain and snowfall.

Marine biome:  It serves huge amount of oxygen into the environment and absorbs the atmospheric carbon dioxide.

As a result of the activity of human there is a significant decrease in the number of trees. The products now used are synthetically made which were made up of natural fibers previously. The water source such as rivers, lakes, and ponds are polluted due to which many water borne diseases are increasing day by day. The accumulation of waste which are found in marine biome are reducing the number of flora present inside marine ecosystem.

3 0
3 years ago
Read 2 more answers
Destruction of tundra vegetation will likely result in _____.
Nezavi [6.7K]
Okay. The destruction of tundra vegetation will not really freeze the soil or deepen the active zone much. Therefore, A and C are eliminated. The destruction of the vegetation can actually melt permafrost, which contributes to global warming. The answer is D.
5 0
4 years ago
Which is a basic characteristic of all living cell?
Charra [1.4K]

Answer: nucleus

Explanation:

3 0
3 years ago
Other questions:
  • Use the drop-down menus to identify the cause of each chromosomal disorder. DiGeorge syndrome is a result of , where part of chr
    11·2 answers
  • Some inquisitive students found two slugs and wanted to take them to science class. The only container they could find was a use
    13·2 answers
  • Natural selection acts on a variation of populations of living things usually through a specific trait which statement must be t
    11·2 answers
  • According to the video shown in class what happens when carbon Bonds are broken.
    11·2 answers
  • homeo- comes from a greek word means still the suffix stasis comes from "stoppage" or "standstill" how does this relate to homeo
    15·1 answer
  • What is the genotype of a person with type A blood, who had a father with type O blood?
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following occurs during mitosis but
    10·1 answer
  • 6<br><br>points!!!!!!!! <br><br>Define graft in biology ​
    7·2 answers
  • .
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!