1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vadim26 [7]
2 years ago
8

Explain what a magnetic field is and its force.

Biology
1 answer:
Elden [556K]2 years ago
8 0

Answer: G00gle

Explanation: Magnetic force, attraction or repulsion that arises between electrically charged particles because of their motion. The magnetic force between two moving charges may be described as the effect exerted upon either charge by a magnetic field created by the other.

You might be interested in
A rock is dropped into a graduated cylinder filled with 35 mL of water what is the volume of the rock helppp
Serga [27]

Answer:

C 5 cm3

Explanation:

4 0
3 years ago
What is a scientific question that can be asked about the insect in the photo?
lidiya [134]
How does the indents appearance affect its survival
3 0
2 years ago
How can we save endangered animals?
Roman55 [17]

Answer:

There are a couple ways to save endangered animals.

Explanation:

First off, spreading awareness and attention about the topic of endangered animals is important so more people can talk about it. Secondly, you can donate to some organizations helping with species endangerment. Also boycotting your favorite clothing brands that may include harming animals can help.

6 0
3 years ago
Which of the following statements about archaea are true cowan?A) They are prokaryotes.B) They lack peptidoglycan in their cell
Veseljchak [2.6K]

Answer:

All the options are true except option D.

Explanation:

Archaea are a group of prokaryotic organisms i.e. they lack a membrane bound nucleus. They are one of the the three domains of life (the other two being bacteria and eukarya). Archeans possess a cell wall like bacteria but it is not composed of peptidoglycan, like bacteria cell wall.

Archeans are generally known to be found in very severe environmental conditions, hence, they are referred to as extremophiles e.g Some are thermoacidophiles i.e. thrive in very hot and acidic environment while others are extreme halophiles i.e. thrive in salty regions. Archeans known as methanogens produce methane gas as a product of metabolism from carbon dioxide and hydrogen.

However, the domain archeae was only found to be in existence recently after the domain bacteria, hence, they are not considered to evolve before the domain bacteria.

3 0
3 years ago
In a sample of cells, the DNA content immediately following mitosis is measured and is equal to 10 picograms of DNA per nucleus.
Rasek [7]

Answer:

1. At the end of S phase- 20 pg DNA

2. At the end of G2 phase-  20 Pg DNA

Explanation:

The cell before undergoing M phase undergoes the steps of interphase that is G₁, S and G₂ phase.

During S phase, the process of cell replication takes place which replicates the DNA as a result of which the amount of DNA doubles. This DNA amount is reduced to half during the anaphase stage of M phase.

In the question since the amount of DNA is 10pg therefore the amount will be double during S phase and becomes 20 pg and will remain 20 pg until the DNA is distributed therefore at the end of G₂ phase Will remain the 20 pg.

7 0
3 years ago
Other questions:
  • What is a population? How do different populations affect one another?
    6·1 answer
  • Which is a product of the Krebs cycle<br><br> A. ADP<br> B. NADH<br> C. pyruvate<br> D. glucose
    10·1 answer
  • Where does the energy come from to make NAPH in the light reactions?
    12·1 answer
  • A gated channel in a cell membrane allows
    12·2 answers
  • Explain the impact of the increased carbon dioxide emissions on the environment
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Reactions that produce energy are said to be
    14·2 answers
  • What wind happens during the night at the beach
    10·2 answers
  • Look at this graph:
    6·1 answer
  • which kingdom consists of organisms that can be classified as either plants-like,fungi-like,or animal-like ?​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!