1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
15

Please help me with this it’s the last one I need

Biology
1 answer:
RideAnS [48]3 years ago
7 0

Answer:

species

Explanation:

please mark me brainliest and 5 star

You might be interested in
Which of the following is likely to form the greatest number of bonds?
balandron [24]

Answer is Nitrogen, atomic number 7

The atomic number of nitrogen is 7. Hence, the number of electrons in the nitrogen atom is 7. In the nitrogen, valance electrons are 3 in number in 2P orbital. Its valency is 3. Therefore, it can make three bonds with other elements which is highest among the given options.

4 0
3 years ago
1. What percentage of puppies would have the same genotype as the<br> parents, Ww?
wolverine [178]

Answer:

50%

Explanation:

This question involves a single gene with two alleles W and w in puppies. According to the question, the genotype of the parent organisms are Ww. In a cross between the two parents i.e. Ww × Ww, the following gametes will be produced by each parent: W and w.

Using these gametes in a punnet square (see attached image), the following genotype of offsprings will be produced: WW, Ww, Ww, ww. Hence, based on this question, the percentage of puppies that would have the same genotype as the parents, Ww are 1/2 × 100% = 50%.

8 0
3 years ago
Help <br> Nucleic acid <br> Certain protein<br> Cell membranes<br> Certain carbohydrates
viktelen [127]
Certain Protiens, amino acids form protiens
8 0
3 years ago
what role will nature selection most likely have in the frequency of the alleles responsible for the presence of tissue pockets
Jet001 [13]

Answer:

Through natural selection, those organisms which have better adaptations to survive in an environment are able to live and pass on their alleles to their offsprings. Hence, any trait which is beneficial to an organism will be favoured by natural selection.

As tissue pockets is a trait which is required by the shrimps, hence with the passage of time shrimp population having tissue pockets will increase and will be favoured by nature.

7 0
4 years ago
What is used to find genetic defects and involved take samples of hair-like material that surrounds the unborn baby?
den301095 [7]
Chorionic Villus Sampling. Definition: CVS is a test where the doctor collects a tiny piece of the placenta, called chorionic villus, which is then tested to check for chromosomal or genetic disorders in the baby.
8 0
3 years ago
Other questions:
  • If the offspring of a cross between two autosomal traits show a phenotypic ratio of 0 dom/dom : 0 dom/rec : 1 rec/dom : 1 rec/re
    8·1 answer
  • Which of the following activities would have the greatest impact on the amount of dirt, oil and other contaminants added to the
    7·2 answers
  • Human mouse chicken sheep baboon
    6·2 answers
  • Which organelle plays a role in intracellular digestion? Which organelle plays a role in intracellular digestion? chloroplast ly
    11·1 answer
  • A plant scientist was hired by a greenhouse operator to devise a way to force iris plants to bloom in the short days of winter.
    13·1 answer
  • All nucleic acids contain a functional group that is also found in the subset of lipids that make up biological membranes. What
    8·1 answer
  • What are the effects of the coriolis effect?
    5·1 answer
  • Which is most likely to result after a farmer sprays his crops with pesticides
    8·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • WILL MARK BRAINLIEST!!!! AND 50 PTS.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!