1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
V125BC [204]
4 years ago
7

What is the correct description of the components of an ATP molecule?

Biology
1 answer:
ozzi4 years ago
5 0

ATP molecule functions as the power source for a cell. Sometimes it is compared to a battery, which is a pretty fair analogy, but it is more mobile and flexible in its functions than a battery is.
You might be interested in
Which of the following is an example of an X-linked recessive disorder?
yKpoI14uk [10]
An example for X-linked recessive disorder is (C). Color Blindness 
3 0
3 years ago
Density-dependent inhibition is a phenomenon in which crowded cells stop dividing at some optimal density and location. This phe
Brilliant_brown [7]

Answer:

This statement is true

Explanation:

Different substances such as growth factors and nutrients affect the mechanism of density-dependent inhibition of growth as cells become more and more numerous

8 0
4 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
What is the end result of DNA replication?
swat32
Two identical DNA strands
7 0
3 years ago
Read 2 more answers
The flat area surrounding the mouth of the Mississippi River is covered with rich sediments important to farming in this area. T
leonid [27]

The answer is A, delta.

I know this because i had this on USATestPrep and got it correct :D

6 0
4 years ago
Other questions:
  • Which term correctly identifies this part of a dermal (skin) cell?
    14·2 answers
  • A 20 fluid oz. soda contains 201 calories. how many kilojoules does the soda contain?
    11·2 answers
  • The focus of _____ was to uncover the elements of the mind, while _____ focused on identifying what thoughts, feelings, and beha
    5·1 answer
  • What is a benifet of using technology to transport water
    15·2 answers
  • How do humans affect biomass<br><br> Pls help me I can’t find anything
    11·1 answer
  • Fdsci 101 what general trend do you observe relative to the masses of these species? question 3 options: all species basically h
    15·1 answer
  • Fossils buried in Earth's continents are older than those found on the the ocean floor. True or false
    12·1 answer
  • SpongeBob and his pal Patrick love to go jellyfishing at Jellyfish Fields! The fields are home to a special type of green jellyf
    10·1 answer
  • How are sexual and asexual reproduction alike? A minimum of two ways.​
    11·1 answer
  • Which sequence of structures correctly indicates the direction in which an electrical signal is carried in a typical multipolar
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!