1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nonamiya [84]
2 years ago
5

Cómo se trasmite la gonorrea?​

Biology
1 answer:
Andrew [12]2 years ago
8 0

Answer:

Contagioso

CÓMO SE CONTAGIA

De madre a hijo durante el embarazo, el parto o la lactancia.

Por relaciones sexuales vaginales, anales u orales sin protección

Explanation:

<em><u>E</u></em><em><u>SPERO </u></em><em><u>TE </u></em><em><u>SIRVA</u></em><em><u> </u></em>

You might be interested in
Which of these is an external pest
scZoUnD [109]

Answer:

C

Explanation:

Lice. External parasites are those that live on the outside of the body. A few of the most common external parasites that affect beef animals

4 0
2 years ago
Read 2 more answers
The small in holes found on the plant leaves are called ​
BabaBlast [244]

There are called the stomata

6 0
3 years ago
The offspring of sexually reproducing organisms can be distinguished from the offspring of asexually reproducing organisms by st
Anettt [7]

Answer:The extent of variety in the genetic information in the population of offspring.    

Explanation:C is correct

4 0
3 years ago
Read 2 more answers
Which of the following is/are common to chemiosmosis and the light-dependent reactions of photosynthesis? electron transport onl
blondinia [14]

Answer:

Both electron transport and a proton gradient

Explanation:

The process of oxidative phosphorylation in mitochondria and electron transport chain in photosynthesis undergo chemiosmosis to produce ATP molecules.

Chemiosmosis is a process where the energy utilized by the movement of proton and electrons produces ATP molecules.

Both the processes involve the movement of electrons through electron carriers where the reduced energy is utilized to drive the flow of protons through the plasma membrane. This creates a proton gradient across the plasma membrane which rotates the ATP synthase and converts the ADP molecules into ATP molecules.

Thus, the selected option is correct.

3 0
2 years ago
I am arranged as a double helix, and my shape is often described as a “twisted ladder”
yuradex [85]
The answer to this question is DNA ONLY!
5 0
2 years ago
Read 2 more answers
Other questions:
  • As the nurse inspects the perineum of a client who is in active labor, the client suddenly turns pale and states that she feels
    8·1 answer
  • In the cell, which organelle has the function of using oxygen in the breakdown of glucose, releasing energy and carbon dioxide?
    7·2 answers
  • A closed car with the windows rolled up heats up on sunny days because of _____. global warming the greenhouse effect convection
    12·2 answers
  • Below, can you use the word CELL in a sentence
    7·2 answers
  • What is it called when you change something from one language into another
    11·2 answers
  • Help with my biology
    8·2 answers
  • Is a chicken egg biotic (living) or abiotic (non-living)? *
    14·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Would a cell that did not undergo cytokinesis be able to function properly? Explain.
    15·1 answer
  • The diagram is a model of one way that materials move across the cell membrane. Oxygen molecules are represented by two ridge ci
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!