1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dybincka [34]
3 years ago
7

Change of phase is a process whereby matter changes form (solid, liquid, gas).Which one of the following constitutes a phase cha

nge?
*Burning of wood
*digestion of food
*exhaling
*melting of candle wax
*photosynthesis
Biology
2 answers:
lesya692 [45]3 years ago
7 0
Melting of candle wax. (starts off a solid, then burn it with a candle and it becomes a liquid, last, it will evaporate and become a gas
Leviafan [203]3 years ago
4 0
Melting of candle wax. Solid wax becomes liquid. You can try it home :)
You might be interested in
What would happen if the cell went<br> through mitosis but not cytokinesis?
cupoosta [38]

Answer/Explanation:

The result of mitosis without cytokinesis will be a cell with more than one nucleus. Such a cell is called a multinucleated cell. This can be a normal process. For example, humans have certain multinucleated bone cells (osteoclasts) that are formed this way

3 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Why is genetic variation important? Select all that apply:
Sladkaya [172]

Answer:

Genetic variation in a group of organisms enables some organisms to survive better than others in the environment in which they live. Organisms of even a small population can differ strikingly in terms of how well suited they are for life in a certain environment.

Explanation:

Genetic variations are important because a diverse gene pool is good for long-term survival of a species since the environment is always changing, so the diversity of DNA offers the most fit of the species a better chance of surviving because they are most adapted to the constantly changing environment.

7 0
1 year ago
What is the term for a localized group of organisms belonging to the same species?
77julia77 [94]

Answer:

c. population

Explanation:

A localised group of organisms that belong to the same species is called Population. This can be a local population if the organisms stay at a particular place or a metapopulation if the organisms tend to move from one geographical location to another.

4 0
2 years ago
EXPERT HELP I'LL GIVE BRAINLIEST:
kupik [55]
You are right it’s D
Wish you luck
6 0
2 years ago
Other questions:
  • The ion imbalance known as ________ initially leads to ________ in excitable cells
    11·1 answer
  • What is the best definition of directional selection
    12·2 answers
  • How do babies know , it is necessary to drink milk when they get hungry??? Even though their brain is underdevelopment?
    11·2 answers
  • Starting from a single individual, what is the size of a population of bacteria that reproduce by binary fission every 20 minute
    7·1 answer
  • Which analysis can be used to make decisions about resource use and consumption​
    6·1 answer
  • A protein is being when what happens?​
    13·1 answer
  • I need help <br> A)16<br> B)9<br> C)3<br> D)6
    10·1 answer
  • Which of the following factors most likely limits the plant population growth in the desert?
    6·1 answer
  • Which of the following is not a tectonic boundary
    8·1 answer
  • Which of the following is a farming approach to increasing crop yield that is applicable around the world, but of particular int
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!