1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reptile [31]
3 years ago
9

Winged insects typically have four wings. These wings grow out the -----------------.

Biology
1 answer:
Monica [59]3 years ago
7 0
Your answer should be abdomen hope this helps
You might be interested in
Alexander was studying the affect of playing rock music on plant growth. One of the plants was exposed to rock music for 24 hour
attashe74 [19]
C) the answer is c 8 decimeters
5 0
3 years ago
Read 2 more answers
There are 7 oak trees and 32 pine trees in the park. how many trees are in the park
andrezito [222]
There are 39 trees in the park
5 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
~fourth largest plate
scoray [572]

Answer:

Option (A)

Explanation:

The African plate is usually referred to as the fourth major (largest) tectonic plates that cover the continent of Africa and a portion of both the Atlantic and Indian ocean.

This plate shares a convergent plate boundary with the Eurasian plate towards its western side, where the African plate being denser subducts below the lighter Eurasian plate

It shares a boundary with the two smaller plates namely the Somalian and the Arabian plate towards its eastern side.

Thus, the correct answer is option (A).

6 0
3 years ago
If you are dehydrated, what will the nephron do with the water in the filtrate ?
Temka [501]
It will reapsorb it to prevent more water loss
6 0
3 years ago
Other questions:
  • What structure brings tRNA and mRNA together
    10·2 answers
  • 1. Which of the following levels of protein organization shows the complete 3-D arrangement of the polypeptide chain?
    13·1 answer
  • An allergic reaction to certain cosmetics or chemicals that cosmetologists may be susceptible to is called:
    14·1 answer
  • Whats the answer guys help me out
    11·1 answer
  • Bees use nectar from the flowers of plants as food. As they collect nectar, dustlike pollen grains stick to their body. When the
    5·1 answer
  • Which of the following steps is important to critical thinking?
    10·2 answers
  • Rhonda Runsalot is a 20 year old woman. She is running at VO2max. Her heart rate is 200 b/min. Her stroke volume is 100 ml blood
    7·1 answer
  • Some homes have stairs that are too steep or narrow for moving large pieces of furniture. In such cases, furniture may be lift e
    14·1 answer
  • U-Science-Gr7-Unit5-PBT-C!
    15·1 answer
  • Which part of the cell is shown in the picture?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!