Answer:
After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is
Explanation:
1. AACGTACGATCGATGCACATGCATGGCTACGC
Complementary strand
TTGCATGCTAGCTACGTGTACGTACCGATGCG
Protein encode: NVRSMHMHGY
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
Complementary strand
GGGCCCATACGTACATGCATGCAGCATATAGC
Protein encode: PGYACTYVVY
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
Complementary strand
GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA
Protein encode: RDRAIDECLV
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
Complementary strand
AATTTGCTCGACGATCGATAAAAATTTTGGGGC
Protein encode: LNELLAIFKTP
Answer: TOXICOLOGY
Explanation: Toxicology is a branch of science that studies that adverse effects that occurs in living organisms when exposed to chemicals and physical agents.
Toxicology deals with risk assessment.
In toxicology, observation and reporting of the symptoms, mechanism of action, detection and treatment of toxic substances when exposed to living organisms especially humans are carried out.
The knowledge of toxicology aids in the advancement of environmental health.
<span>Thymine Is 20% in the DNA molecule.
Hope this helps.
</span>
Answer No 1:
Phospholipids are made up of phosphorus head and two fatty acid molecules. These phosphorus head and fatty acid tail is joined together by glycerol. Fatty acid molecules are made up of Carbon, hydrogen and oxyge. Hence,carbon and hydrogen can be said as two other elements present in phospholipids.
Answer No 2:
The building blocks of lipids are glycerol and fatty acids.
Lipids can be described as vital organic molecules which are not soluble in water. They are made up of chains of carbon, hydrogen and oxygen. Someof the examples of lipids are fats and oils. Lipids are the main molecules present in an organisms cell membrane and hence have huge biological importance.
Answer No 3:
Lipids are biologically important molecules as they play very vital roles in the functioning of an organisms body. Two of the functions of lipids are:
- Lipids and phosphorus molecules combine to form phospholipids. The phospholipids are the main molecules out of which the cell membrane is made. Hence, lipids play an essential role in providing the cell membrane its structure.
- Lipids store energy and provide insulation to the body of an organism.