In a desert, the climate is “hot” and “dry”.
Answer:A plane's engines are designed to move it forward at high speed. That makes air flow rapidly over the wings, which throw the air down toward the ground, generating an upward force called lift that overcomes the plane's weight and holds it in the sky. ... The wings force the air downward and that pushes the plane upward.
Answer:
IV ga bhi ha of A bhi new IV fa obc ve vo BBQ of vo BBQ of BBQ bjp ca ko a ko CQ icici baba icici baba PvP xa ov qJ iv in bhi few IV rrb
Explanation:
bjp CQ no BBQ on ex of ex of vo name PvP CQ on VB ph qr up wo pr to or roo ro pr to or to or to Uriel's go ca wo
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
they mine for hard materials in Florida so it would be, b,c,e.
Explanation:
