1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xz_007 [3.2K]
3 years ago
15

The strongest evidence for evolution was not known in Darwin's time. It involves comparing the ______ of different species to de

termine how closely related they are.
Biology
2 answers:
Colt1911 [192]3 years ago
6 0

DNA

PLS MAKE BRAINLEST {}

marishachu [46]3 years ago
5 0

dna

Explanation:

it involves comparing how closely related they are

You might be interested in
4. Change any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid
ruslelena [56]
Q1) 

the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.

<span>5’ agcggg  atg  agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here 
we change base A to T (capitalised)

DNA sequence with amino acids are given 
</span>5’ agcggg  atg  Tgc gca  tgt  ggc gca taa ctg 3’
N               Met Cys Ala Cys  Gly Ala stop 
after changing the base the amino acid sequence changes from Ser to Cys.

Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts 
</span>5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt  atg  cgc  cac  atg  cgc Aca tcc  cgc t 3'
              Met Arg  His Met  Arg  Thr Ser Arg
amino acid changes from Ser to Thr.

Q3) 
The sequence with amino acids before inserting a base is 
5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
We insert a base G shown in capitals 
5’ agcggg  atg  agc Ggca tgt  ggc gca taa ctg 3’

  This changes the codons of bases after the inserted base
5’ agcggg  atg  agc ggc atg  tgg  cgc ata act g 3’
                 Met  Ser Gly Met Trp Arg  Ile  Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
 to   Met  Ser Gly Met Trp Arg  Ile  Thr
                  
Q4)
the complementary strand before adding a base is 
5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
When we insert a base G, base C is added to the complementary strand 
5' cagtt  atg  cgc  cac  atg  cCgc tca tcc  cgc t 3'
this changes the codons
5' cagtt  atg  cgc  cac  atg  cCg ctc atc ccg ct 3'
              Met Arg His  Met  Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from 
Met Arg  His Met Arg  Ser Ser Arg 
to Met Arg His  Met  Pro Leu Ile Pro
7 0
3 years ago
Why are recessive alleles not always shown in the offspring?
3241004551 [841]

Explanation:

Recessive alleles lack the power to express the phenotypic traits of an organism. In order for the specific trait to be expressed, 2 copies of the recessive allele or homogenous recessive genotype is needed in the organism.

5 0
3 years ago
Why would cells die if they were unable to make (or otherwise obtain) the amino acid arginine?
kumpel [21]

Answer: Arginine is an amino acid that is incorporated into proteins. So if cells can not make or obtain arginine, the cell can not make proteins needed for survival.

Explanation:

Arginine is an amino acid used to build proteins, and it is classified as a semiessential or conditionally essential amino acid.

Proteins are large molecules consisting of long chains of amino acids. They perform many functions such as catalysing metabolic reactions, providing structure to cells and organisms, and transporting molecules, among many others.

Most notably, arginine is part of proteins that play an important role in many different processes such as cell division, immune function, wound healing and the release of hormones. <u>Without this amino acid, the cell cannot manufacture the proteins necessary for proper functioning</u>. So the cell dies because it cannot function properly.

6 0
3 years ago
what do biologists study changes in amino acid sequence when trying to determine causes of genetic variation?
baherus [9]

Answer:

reason for studying human genetics is that it gives us a powerful tool for understanding and describing human evolution. At one time, data from physical anthropology (including information about skin color, body build, and facial traits) were the only source of information available to scholars interested in tracing human evolutionary history. Today, however, researchers have a wealth of genetic data, including molecular data, to call upon in their work.

3 0
3 years ago
How does blood move in a tadpoles circulatory system ​
USPshnik [31]

Answer:

TADPOLE:

  • Unlike a frog, a tadpole has a<u> two chambered heart</u> (there is only one atrium and one ventricle).
  • The blood travels through the body as follows: All the blood in the body moves to the atrium, then the heart relaxes and the blood moves to the ventricle.

FROG:

  • The frog heart has 3 chambers: two atria and a single ventricle. The atrium receives deoxygenated blood from the blood vessels (veins) that drain the various organs of the body. The left atrium receives oxygenated blood from the lungs and skin (which also serves as a gas exchange organ in most amphibians). #answerwithquality #BAL
3 0
3 years ago
Other questions:
  • Which of the following statements is true of osmosis? (Hint: remember my slug example in the Zoom class!) a. Water moves from an
    13·1 answer
  • What is a species?<br> (you can come up with your own definition based on your current knowledge!)
    15·2 answers
  • New-born babies of what animal are six feet tall and weigh almost 200 pounds?
    13·1 answer
  • An important challenge to traditional (pre-1860) ideas about species was the observation that seemingly dissimilar organisms, su
    6·1 answer
  • Atp synthesis in chloroplasts is very similar to that in mitochondria: electron transport is coupled to the formation of a proto
    11·2 answers
  • Next the researchers repeated the experiment in Part C but instead of mixing the AX and AY strains, they put one strain on each
    6·1 answer
  • Along with water conservation animals also have unique characteristics for
    7·1 answer
  • Explain how various animal species have rapidly evolved as a result of human impact.
    5·1 answer
  • Cellular respiration takes place in two stages: glycolysis, then i espiration respiration, then glycolysis glycolysis and fermen
    5·1 answer
  • What do the parasympathetic and sympathetic divisions have in common?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!