Q1)
the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.
<span>5’ agcggg atg agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here
we change base A to T (capitalised)
DNA sequence with amino acids are given
</span>5’ agcggg atg Tgc gca tgt ggc gca taa ctg 3’
N Met Cys Ala Cys Gly Ala stop
after changing the base the amino acid sequence changes from Ser to Cys.
Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts
</span>5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt atg cgc cac atg cgc Aca tcc cgc t 3'
Met Arg His Met Arg Thr Ser Arg
amino acid changes from Ser to Thr.
Q3)
The sequence with amino acids before inserting a base is
5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
We insert a base G shown in capitals
5’ agcggg atg agc Ggca tgt ggc gca taa ctg 3’
This changes the codons of bases after the inserted base
5’ agcggg atg agc ggc atg tgg cgc ata act g 3’
Met Ser Gly Met Trp Arg Ile Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
to Met Ser Gly Met Trp Arg Ile Thr
Q4)
the complementary strand before adding a base is
5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
When we insert a base G, base C is added to the complementary strand
5' cagtt atg cgc cac atg cCgc tca tcc cgc t 3'
this changes the codons
5' cagtt atg cgc cac atg cCg ctc atc ccg ct 3'
Met Arg His Met Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from
Met Arg His Met Arg Ser Ser Arg
to Met Arg His Met Pro Leu Ile Pro
Explanation:
Recessive alleles lack the power to express the phenotypic traits of an organism. In order for the specific trait to be expressed, 2 copies of the recessive allele or homogenous recessive genotype is needed in the organism.
Answer: Arginine is an amino acid that is incorporated into proteins. So if cells can not make or obtain arginine, the cell can not make proteins needed for survival.
Explanation:
Arginine is an amino acid used to build proteins, and it is classified as a semiessential or conditionally essential amino acid.
Proteins are large molecules consisting of long chains of amino acids. They perform many functions such as catalysing metabolic reactions, providing structure to cells and organisms, and transporting molecules, among many others.
Most notably, arginine is part of proteins that play an important role in many different processes such as cell division, immune function, wound healing and the release of hormones. <u>Without this amino acid, the cell cannot manufacture the proteins necessary for proper functioning</u>. So the cell dies because it cannot function properly.
Answer:
reason for studying human genetics is that it gives us a powerful tool for understanding and describing human evolution. At one time, data from physical anthropology (including information about skin color, body build, and facial traits) were the only source of information available to scholars interested in tracing human evolutionary history. Today, however, researchers have a wealth of genetic data, including molecular data, to call upon in their work.
