Answer:
C. are found in the heart
Explanation:
Striated musculature is comprised of two types of tissues: skeletal muscle and cardiac muscle. Skeletal muscle is the tissue that most muscles attached to bones are made of. Hence the word "skeletal". Cardiac muscle, on the other hand, is the muscle found on the walls of the heart.
There
are many ways to estimate ground squirrel numbers. The most common
and popular monitoring technique is the combination of electronically
recorded stress calls and visual counts where ground squirrels
respond physically, vocally or both. You simply count the number of
squirrels in a 100m by 100m area that respond to a hand-held
imitation ground squirrel call tool.
<span>I
hope this helps, Regards.</span>
Answer:
Genes are a set of instructions that determine what the organism is like, its appearance, how it survives, and how it behaves in its environment. Genes are made of a substance called deoxyribonucleic acid, or DNA. They give instructions for a living being to make molecules called proteins
Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
Avoid touching it, if a mole is picked at and is expanding this can becaome a serious problem causing infection if picked at, if it continues to grow you might needd to see a doctor or a dermatologist
