1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitrij [34]
2 years ago
11

To which structure does an anticodon bind?

Biology
1 answer:
myrzilka [38]2 years ago
5 0

Answer:

the anticodon sequence will blind to the codon of the mRNA

You might be interested in
Quienes hacen quimiosíntesis??
Westkost [7]

Answer:

quimoautótrofos, quimiolitótrofos o quimiolitoautótrofos

Explanation:

4 0
3 years ago
Read 2 more answers
Unlike in prokaryotic cells, replication in eukaryotic cells...
Kitty [74]
The answer is B) can start in many different places in a sequence at the same time.
These different places are called Origin of replication. :)))
i hope this is helpful
have a nice day  
4 0
3 years ago
Describe how the sea snail and the periwinkle are connected to each other​
Anna [14]

Answer:

they move together

Explanation:

lol

5 0
2 years ago
Read 2 more answers
Define Electricity
aev [14]

Answer:

To back away

Explanation:

To back away because magnets are different and is they are put the wrong the way it moves back

8 0
3 years ago
What are some values of trees?​
muminat

Answer:

Treest are an Investment

They beautify our surroundings, purify our air, act as sound barriers, manufacture precious oxygen, and help us save energy through their cooling shade in summer and their wind reduction in winter.

Hope its help

8 0
2 years ago
Read 2 more answers
Other questions:
  • What are the genotypes of gametes of a AaBb self-pollination?
    11·1 answer
  • During an expedition, a scuba diver saw an animal use stinging tentacles to capture and eat its prey. Which animal did the diver
    14·2 answers
  • The electromagnetic waves with the shortest wavelengths and the highest frequencies are called
    11·2 answers
  • During which phase of mitosis do the nuclear membrane dissolve
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What are the differences between a prokaryotes and eukaryotes?
    9·2 answers
  • What is photosynthesis??
    14·1 answer
  • PLEASE ANSWER ASAP!!!
    6·2 answers
  • Two ramps of equal height are placed 1 m apart, and balls of equal mass are released from the top of each ramp. What happens to
    15·2 answers
  • Luis created a clay model of Earth. He used a toothpick to represent Earth's axis. The toothpick was stuck horizontally through
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!