1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
noname [10]
3 years ago
8

HELP PLEASE WILL GIVE BRAINLY!! What is a complementary RNA strand to TAG?

Biology
1 answer:
Kryger [21]3 years ago
6 0

Answer:

It's AUC.

Thymine is substituted by Uracile in RNA and it's complementary to Adenine. Citosine is complementary to Guanine

You might be interested in
How many hearts does the octopus have ?​
ira [324]

Answer:

3

Explanation:

4 0
3 years ago
Read 2 more answers
Students want to find out at which temperature bean plants grow the tallest. Which science process skill would be used to find t
timurjin [86]

Answer:

scientific method

Explanation:

7 0
3 years ago
Why does salt melt frogs
Pie
Frogs have very moist skin, when the come in contact with the salt it burns the frog and quickly dehydrates the frog and can result in death for the frog.
6 0
3 years ago
I need help with the hole thing!
Tcecarenko [31]
Post the entire document please so i can find the answers to the entire thing.
6 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • A(n) _____ is someone whose biological gender is ambiguous or uncertain, often having reproductive structures that may be partly
    7·1 answer
  • Who wrote principles of geology and emphasized the principle of uniformitarianism?
    6·1 answer
  • Ugh i need more help
    13·2 answers
  • What is the best evidence that two organism share a common evolutionary ancesery
    5·1 answer
  • How does embryonic development and cell differentiation in
    14·1 answer
  • Hi guys! I will give BRAINLIEST to the person who can answer this question confidently! (this is for honors bio btw) I think it
    12·1 answer
  • What non infectious disease caused by​
    6·1 answer
  • The cladogram shown here shows similarities and differences among several classes of vertebrates. Anatomically, the four have __
    11·2 answers
  • Hurricanes die when they move over land because
    13·1 answer
  • Based on Darwin's observations, what is the best possible explanation that two organisms that live very far away from each other
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!