1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
13

Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, t

hat codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator.
5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3
3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5
promoter terminator
Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice.
A. Top
B. Bottom
C. Either can serve as the codong strand
D. There isn't enough information to determine which is the coding strand
Biology
1 answer:
Serjik [45]3 years ago
6 0

Answer:

D. There isn't enough information to determine which is the coding strand

Explanation:

In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.

You might be interested in
Sympathetic nervous system vs parasympathetic nervous system
AveGali [126]

Answer:

Differences between Sympathetic and Parasympathetic

1. Anatomical: The location of preganglionic neurons of the autonomic ganglia and the extension of preganglionic and postganglionic fibers are different in these two systems;

2. Pharmacological: In the Sympathetic system we have the presence of Cholinergic fibers (Ach) and in the Parasympathetic system we have the presence of Noradrenergic fibers (NE);  

3. Physiological: They act antagonistically, they rarely work harmoniously synergistically in coordinating visceral activity (balance)

7 0
4 years ago
Organisms must maintain _____, which is a balance of internal conditions. homeostasis
prohojiy [21]
The answer is homeostasis
7 0
3 years ago
Read 2 more answers
What process takes place when oxygen is not available for cellular respiration
nlexa [21]

There is a backup system that your body uses to create ATP, and it is called Anaerobic Respiration.

7 0
3 years ago
I need help with a project. I'll give brainliest. What is a stimulus? I can't get a good enough answer lol
vladimir2022 [97]

Answer:

a thing or event that evokes a specific functional reaction in an organ or tissue

a thing that rouses activity or energy in someone or something; a spur or incentive

an interesting and exciting quality.

Explanation:

6 0
2 years ago
Bottom-up processing involves the ____.​ select one:
lina2011 [118]

Answer;

A. ​brain's use of incoming signals to construct perceptions


Explanation;

Bottom-up processing involves processing information by starting with the individual elements of a visual stimulus and gradually building up a final representation and interpretation.

The evidence of bottom-down processing by Hubel and Wiesel showed that we have neurons that pick up specific elements of a visual stimulus and then they are assembled into a more complex form.

6 0
4 years ago
Other questions:
  • Kiara pours measures the mass and volume of four mystery liquids and pours them into a beaker the liquids separate into differen
    6·1 answer
  • What are the three components of cell theory
    15·2 answers
  • How does mutation, random fertilization, and crossing over contribute to genetic variation?
    14·1 answer
  • ________ is a condition in an experiment that remains the same.
    14·1 answer
  • Which one of the following discoveries involving DNA happened first?
    10·1 answer
  • Which statement about the pancreas is not true?
    14·1 answer
  • What is the simplest level of organization in a human being?
    6·1 answer
  • Our system of taste envolved for a world where food was blank and blank was a real threat
    12·2 answers
  • If a disease destroying barley plants in in a field swept through an ecosystem, what would happen to the barley eating bird popu
    14·2 answers
  • What are the stages of mitosis​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!