1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
13

Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, t

hat codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator.
5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3
3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5
promoter terminator
Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice.
A. Top
B. Bottom
C. Either can serve as the codong strand
D. There isn't enough information to determine which is the coding strand
Biology
1 answer:
Serjik [45]3 years ago
6 0

Answer:

D. There isn't enough information to determine which is the coding strand

Explanation:

In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.

You might be interested in
What is the corresponding mRNA sequence from the DNA strand CGA TTA CAG
marshall27 [118]

Answer:

CGA-TTA-CAG

GCU-AAU-GUC

Explanation:

Please check with the codon chart and see if I am correct.

6 0
2 years ago
You are conducting a CRISPR-Cas9 experiment. You transform a cell with Cas9 and a guide RNA (contains the scaffold and guide seq
SOVA2 [1]

Answer:

Cas9-sgRNA cannot align with targeted DNA sequence

Explanation:

Without a PAM sequence, the CRISPR-sgRNA (small guide RNA) complex cannot align with the targeted DNA sequence. Therefore, you cannot perform experiments (e.g. gene editing) using CRISPR-Cas9.

8 0
3 years ago
Identify the other key structures that indicate the probable origin of a chloroplast
fiasKO [112]
<span>Chroloplasts Acts as a main role in photosynthesis.Chloroplasts likely orginated from engulfed "prokaryotes" that once lived as independent organisms. They are also considered to be originated from "cyanobacteria" through endosymbiosis—when a eukaryotic cell engulfed a photosynthesizing cyanobacterium that became a permanent resident in the cell.</span>
4 0
3 years ago
What is the CONTROL variable in this experiment? (Hint: What is the same for both tests?) *
valkas [14]

Answer:

I dont know what your experiment is but the control variable is the thing your keeping the same.

Explanation:

3 0
2 years ago
How do living things use matter such as carbon, nitrogen, phosphorus and water?
kodGreya [7K]

Answer:

Every living organism is made up of carbon, nitrogen, and phosphates. Nitrogen and carbon are found in amino acids which make up proteins. Phosphates make up DNA and ATP.

Explanation:

7 0
3 years ago
Other questions:
  • What is not a characteristic of water-soluble vitamins?​?
    6·1 answer
  • Bulk movement of water across plasma membranes and the exchange of oxygen from blood into cells are similar in that the method o
    5·1 answer
  • What is the area of calm winds near the equator called?
    12·2 answers
  • Which of the following structures is an extension of the petiole into the leaf blade?
    12·2 answers
  • what conditions create the largest waves in the ocean enter your answer in the space provided please help !!! ​
    9·2 answers
  • Are chloroplasts found in most plant cells explain
    14·1 answer
  • The neural pathway represents the nerves that connect the sense organs to the brain what happens along the neural pathway when t
    15·1 answer
  • What is net force on each item? Type in the number and select the direction from the units.
    15·1 answer
  • How does reflected light help you see objects in shadows?
    5·1 answer
  • Biology, Need help!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!