1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
13

Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, t

hat codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator.
5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3
3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5
promoter terminator
Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice.
A. Top
B. Bottom
C. Either can serve as the codong strand
D. There isn't enough information to determine which is the coding strand
Biology
1 answer:
Serjik [45]3 years ago
6 0

Answer:

D. There isn't enough information to determine which is the coding strand

Explanation:

In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.

You might be interested in
A random change in allele frequency is called __________.
azamat
The answer is genetic drift.
6 0
3 years ago
Which cell structure is found in plant cells, but not in animal cells?
rewona [7]
Plant cells have a cell wall so answer 1
8 0
3 years ago
Read 2 more answers
G you extracted your dna from cheek cells. the concentration of your dna sample is 250 ng/μl. the dna template for pcr should be
Karo-lina-s [1.5K]
You should mix 4µl of DNA sample and complete it with 96µl (100-4) of water.

You can figure this out by using  C1.V1 = C2.V2
C1 = 250 <span>ng/μl (Sample Concentration)
</span>V1 = ?          (the necessary volume to take from the DNA sample)
C2 = 10 <span>ng/μl (PCR concentration)
</span>V2 = 100 µl (total volume)

V1 = \frac{C2 . V2}{C1} = \frac{10 . 100}{250} = 4µl

For the water: 100µl (total volume) = 4µl + Water
Water volume = 96µl
6 0
3 years ago
What are the four major functions all cells perform?
Oliga [24]

Answer: Reproduce, make energy, waste removal, react to changes

Explanation:

8 0
3 years ago
How do organisms affect the environment
Crank

<u>Answer:</u>

Nature consists of both the organism and the environment. The relationship between them are intertwined. Organisms are mainly divided into three

a) The producers

b) The consumers

c) Decomposers

These three organisms are interlinked with each other. Without them there is no existence of the environment. The producers produce the food, the consumers consume them and the decomposers decompose and release it in the form of energy. In each cycle energy is released and absorbed. The balance in the environment is maintained by the food pyramid.

6 0
3 years ago
Other questions:
  • Which kingdom has more more individual organisms than any of the other 5 kingdoms? (Bacteria)
    11·1 answer
  • Insertion of a device into the muscle to measure the pressure within the muscle is monitoring of __________.
    5·2 answers
  • What would happen to a plant if it was put under a green light?
    10·2 answers
  • Is this statement true or false?
    13·2 answers
  • Compare sympathetic vs parasympathetic nervous system
    5·1 answer
  • The continental crust is:
    11·1 answer
  • _____________ are present in an organism, but they don't function in the same way they used to. HELP ILL GIVE BRAINLIEST!!! pict
    12·1 answer
  • Which substance completes passive transports and facilitated diffusion?
    9·1 answer
  • Help me with this question
    14·2 answers
  • PLEASE HELP ME WILL MARK BRAINLIEST LIKE GIVE ME THE REAL ANSWER
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!