Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, t
hat codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3
3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5
promoter terminator
Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice.
A. Top
B. Bottom
C. Either can serve as the codong strand
D. There isn't enough information to determine which is the coding strand
D. There isn't enough information to determine which is the coding strand
Explanation:
In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.
Before puberty, children do have an estrogen level in their body. This is only truly noticeable around the time of puberty. It's always there, but not hyperactive until puberty.
