1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
13

Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, t

hat codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator.
5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3
3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5
promoter terminator
Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice.
A. Top
B. Bottom
C. Either can serve as the codong strand
D. There isn't enough information to determine which is the coding strand
Biology
1 answer:
Serjik [45]3 years ago
6 0

Answer:

D. There isn't enough information to determine which is the coding strand

Explanation:

In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.

You might be interested in
An astronomer states that Star P has a lower absolute brightness than Star Q. How would you translate this observation for a non
aleksandr82 [10.1K]

Answer:

Star P is smaller than star Q

Explanation:

Absolute brightness is defined as brightness of a celestial object or star from a  Standard distance usually taken as 10 parsecs from Earth. If one star is brighther than the other then there can be two variable playing major role given that they are at same distance –  

a) composition of star and

b) Its size.  

The larger the star, the more energy it will emit per second and hence more will be its absolute brightness.  

Thus, star P is smaller than star Q

6 0
3 years ago
A weakness or slight muscular paralysis is known as:
DerKrebs [107]

Answer:

paresis

Explanation:

refers to a condition in which muscle movement has become weakened or impaired. You may also sometimes see it referred to as “mild paralysis” or “partial paralysis.” Although paresis affects your muscles, it usually occurs due to nerve damage.

3 0
3 years ago
Here this is the link to the cells I only need 2
Semmy [17]
1) Muscle Cell*myosin filament: changes shape and pulls on and releases actin filament allowing movement*If the myosin filament was missing or injured, it would be cause difficulty in movement2) Flagellum*Dynein arms: uses energy from ATP to "grab" the attached droplet allowing a wave like movement  when pulling the droplets together* If the dynein arms was missing or injured the flagellum would have no possible way of moving causing it to stuck in mid-air

6 0
3 years ago
"Bald Eagle Facts
Simora [160]
The important part of the text is the following:

<span> "Their most important non-carrion food is fish, which they catch by swooping down and grabbing fish that are near the surface of the water."

We know here that in order to survive, the Bald Eagle needs access to the water - and this water cannot be frozen. So the less ice cover there is, the more food it can obtain!
</span>
4 0
4 years ago
In organisms other than plants, when and where is the most ATP produced?
VARVARA [1.3K]
I feel like the answer is D. Hope this helps!
6 0
3 years ago
Read 2 more answers
Other questions:
  • 1. When Earth first formed, its surface was so hot it<br> liquid, or_, rock.
    10·2 answers
  • What type of organic molecule do you think is shown in the diagram above? Explain your answer.
    13·1 answer
  • Which process in respiration happens first
    12·2 answers
  • 1. Which structures are common to both cells​
    13·1 answer
  • What are aquatic biomes ?
    11·2 answers
  • uppose a person ingests equal amounts of two nuclides, both of which are beta emitters (of roughly equal energy). Nuclide A has
    9·1 answer
  • What can be predicted about a country where there are many more young children than teenagers?
    11·2 answers
  • Which is the best evidence that the climate of a location has changed overtime
    10·1 answer
  • You see an entire pond, with the same plant across most of it. The plant seems to be surviving very well. Which adaptation does
    7·1 answer
  • if there are 80 grams of sodium hydroxide, 44 grams of water, and 62 grams of sodium sulfate, then how many grams of sulfuric ac
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!