1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
13

Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, t

hat codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator.
5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3
3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5
promoter terminator
Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice.
A. Top
B. Bottom
C. Either can serve as the codong strand
D. There isn't enough information to determine which is the coding strand
Biology
1 answer:
Serjik [45]3 years ago
6 0

Answer:

D. There isn't enough information to determine which is the coding strand

Explanation:

In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.

You might be interested in
25. A student measures the distance from a bridge
kkurt [141]

Answer:

(4) As time increased, distance remained

the same

Explanation:

The graph shows that the student measures equal distance everyday from the bridge to the rock for 7 days.

Everyday has an equal distance measured by the student all through the week.

Let's say the point on the vertical axis which represents distance measured is about 1.5 meters. It means that, for day 1, he measures 1.5 meters, day 2, he measured 1.5 meters, by day 3 another 1.5 meters. Same he does for 7 days. For the first 3 days, he would have measured 1.5 m × 3 = 4.5 meters.

This means that, as time (days) increased, distance measured each day remains the same.

6 0
3 years ago
The spinal cord is automatically arranged with
Vinvika [58]

cervical region

spinal nerves

central canal

4 0
3 years ago
Read 2 more answers
It’s biology someone help
Wewaii [24]
Ecosystem and a pond
3 0
3 years ago
The tundra ecosystem of Alaska is known as a “cold desert.” It receives very little precipitation, about four inches annually. H
vlabodo [156]

Answer:

Biotic factors of tundra ecosystem: migratory bird species and mammals such as caribou, foxes, bears, and small rodents.

Explanation:

Biotic component of an ecosystem are the total of all the species of living beings present in the system. It includes species of plant, animals and microbes. Since tundra ecosystem is habitat for migratory bird species and mammals such as caribou, foxes, bears, and small rodents; these living beings serve as biotic component for the system.

8 0
3 years ago
Read 2 more answers
The impacts of currents vary from one body of water or landform to another. How can inlets, like the one shown on the map, be im
KengaRu [80]
The answer to this question will be D
3 0
3 years ago
Other questions:
  • Acid rain only happens in the summer.<br><br> True<br> False
    6·1 answer
  • Triglycerides and cholesterol do not circulate freely in the bloodstream. True or False
    8·1 answer
  • I need to get the answer fast?
    13·1 answer
  • The United States Arctic National Wildlife Refuge is a large portion of Alaska that is protected from construction, which would
    7·2 answers
  • what do you have to do and avoid doing in order that your small intestine is healthy and doesn't catch a disease(also if it is i
    15·1 answer
  • How do chromosomes carry information
    14·2 answers
  • The ability to roll the tongue in humans is coded by the dominant allele R. The inability to roll the tongue is coded by the rec
    7·1 answer
  • Option :<br> Bacteriacial cell <br> Plant cell <br> Animal cell <br> All of these are correct answer
    10·1 answer
  • Can someone please compare and contrast the different types of distribution for populations of animals?
    7·1 answer
  • Without the __, a plant wouldn't have any pollen.<br><br> fruit <br><br> stamen <br><br> nectar
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!