1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
13

Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, t

hat codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator.
5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3
3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5
promoter terminator
Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice.
A. Top
B. Bottom
C. Either can serve as the codong strand
D. There isn't enough information to determine which is the coding strand
Biology
1 answer:
Serjik [45]3 years ago
6 0

Answer:

D. There isn't enough information to determine which is the coding strand

Explanation:

In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.

You might be interested in
Classify various uses of computer technology.
Natalka [10]

Answer:

Online communication, video games, a source entertainment, internet searches, online music

Explanation:These are all used of computer technology.

3 0
3 years ago
What is an ocean habitat?
charle [14.2K]
An ocean habitat is a large body of salty sea water. There are rocks, sand, mud, and seaweed, where some animals make homes or hide from predators.
6 0
3 years ago
Read 2 more answers
Which of these statements is
suter [353]

The statement that is true is active transport moves against the concentration gradient.

<h3>WHAT IS ACTIVE TRANSPORT</h3>

Active transport is one of the two types of cellular transport that involves the movement of molecules against a concentration gradient.

This moves that movement occurs from a region of lower concentration to a region of higher concentration. Since movement is against a concentration gradient, it involves input of energy (ATP).

Therefore, the statement that is true is active transport moves against the concentration gradient.

Learn more about active transport at: brainly.com/question/2503897

6 0
2 years ago
Describes a method in studying plate movements?
scZoUnD [109]

The geometric method gives scientists the spreading direction to go with the spreading speed

4 0
3 years ago
A natural phenomenon that typically influences climate over a period of one to two years is _______.
Andrews [41]

A natural phenomenon that typically influences climate over a period of one to two years is sulfur-rich violent volcanic eruption.

Without any doubt, the most plentiful volcanic gas from a volcanic eruption is water vapor, which is non-dangerous.

Nevertheless, notable volumes of carbon dioxide, sulfur dioxide, hydrogen sulfide as well as hydrogen halides can also be released from volcanic eruptions. This natural phenomenon generally influences climate over a period of one to two years.

The sulfuric acid creates a mist of minute droplets in the stratosphere that reflects the incoming solar radiation, an thus is responsible for cooling of the Earth's surface.

These droplets can stay in the stratosphere for about three years, circulating all over through winds and resulting in consequential cooling all over the world.

To learn more about volcanic eruption here

brainly.com/question/1622004

#SPJ4

4 0
2 years ago
Other questions:
  • Which of the following is not true of the xylem?
    6·1 answer
  • Which part or parts of the paragraph indicate that the ozone layer is depleting?hurry please help fast......!!!!!
    6·2 answers
  • Imagine that you are studying the food preferences of a lizard species across its range. You have hypothesized that because thes
    12·1 answer
  • When skin cells have third-degree burns, skin grafts are used. What is the benefit to using skin grafts?
    7·2 answers
  • A couple has three offspring: one child with an autosomal dominant disease trait and two who are normal. the father is affected
    12·1 answer
  • A woman with color-normal vision, but whose father was color blind, marries a man with normal vision. They are expecting a child
    11·1 answer
  • Which of the following does natural selection act directly upon? Alleles, genes, individual organisms, or mutations?
    6·1 answer
  • The picture below shows the setup for an experiment involving a 1000 ml beaker, sitting on a bumer, filled with 500 ml of water,
    9·1 answer
  • Part C
    6·1 answer
  • Muscular exercise presents a dramatic test of the body's homeostatic control systems because it results in large _____.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!