1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
13

Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, t

hat codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator.
5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3
3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5
promoter terminator
Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice.
A. Top
B. Bottom
C. Either can serve as the codong strand
D. There isn't enough information to determine which is the coding strand
Biology
1 answer:
Serjik [45]3 years ago
6 0

Answer:

D. There isn't enough information to determine which is the coding strand

Explanation:

In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.

You might be interested in
Species A has a diploid number of 42 chromosomes, while species B has a diploid number of 48 chromosomes. Give the chromosome nu
Arada [10]

Answer:

a. autotriploid of species A: 63 chromosomes

b. autotetraploid of species B: 96 chromosomes

c. allotriploid from species A and B: 1) 66 chromosomes and 2) 69 chromosomes

Explanation:

<u>For a.</u>

this species will have 3 haploid sets of chromosomes ('tri' means 3)

one haploid set = 21

21 × 3 = 63 chromosomes

<u>For b.</u>

this species will have 4 haploid sets of chromosomes ('tetra' means 4)

one haploid set = 24

24 × 4 = 96 chromosomes

<u>For c.</u>

there are two ways to do this:

1) two sets of chromosomes from species A and one from species B

42 + 24 = 66 chromosomes

2) one set of chromosomes from species A and two from species B

21 + 48 = 69 chromosomes

Hope that answers the question, have a great day!

5 0
3 years ago
A scientist discovers a multicellular creature in a coral reef. Which process do the new organisms use to synthesize DNA before
krok68 [10]

Explanation:

fixofogxfizfififisfiRirifizfizfizfizdjdiy

7 0
2 years ago
The ability of an organism to maintain internal conditions is called _____.
NNADVOKAT [17]

The ability of an organism to maintain internal conditions is called <em>C homeostasis </em>

6 0
2 years ago
Which of the following is not associated with the renal corpuscle?
Black_prince [1.1K]
A vasa recta is not associated with the renal corpuscle, whereas a podocyte, a fenestrated capillary, and an efferent arteriole are.
3 0
3 years ago
What is one defining feature of a prokaryotic cell?
Vanyuwa [196]

Answer:

the answer is D

Explanation:

8 0
2 years ago
Read 2 more answers
Other questions:
  • What happens during crossing over? Homologous chromosomes trade pieces of DNA. Sister chromatids form tetrads and line up random
    7·2 answers
  • The resting cell normally has a net negative charge with respect to the outside of the cell. what is this state called?
    11·1 answer
  • Carmen has a sample of matter. It is clear and smells sour. The sample is also thick but it flows when poured. Which is the best
    9·2 answers
  • One of the most serious infections of the upper respiratory system is ________.
    11·1 answer
  • Which of these is a product of anaerobic respiration? carbon monoxide water lactic acid glucose?
    11·1 answer
  • HELLLLLP!!!!!!! WILL GIVE BRAINLIEST!!!!
    14·2 answers
  • At the set of gas exchange in the lungs, where does the oxygen move?
    13·1 answer
  • Pls help me 30 points ty
    12·1 answer
  • Does anyone know if these are correct, I’m just asking because idk if they are correct or not.
    10·1 answer
  • Once a protein is made, its biochemical and structural properties play a role in producing ________.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!