1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
13

Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, t

hat codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator.
5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3
3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5
promoter terminator
Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice.
A. Top
B. Bottom
C. Either can serve as the codong strand
D. There isn't enough information to determine which is the coding strand
Biology
1 answer:
Serjik [45]3 years ago
6 0

Answer:

D. There isn't enough information to determine which is the coding strand

Explanation:

In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.

You might be interested in
two pea plant with yellow peas are crossed most of their offspring have yellow peas but about 25% of the offspring have green pe
Mrac [35]

Answer:

Both parents have the genes for yellow peas and green peas

Explanation:

If a plant has inherited one yellow peas gene and one green peas gene, the plant will produce yellow peas because (as you mentioned) yellow peas are dominant. that means the parents are heterozygous (Cc). If both parents have the gene versions Cc, then there is a 25% chance the offspring would get the gene version cc, coding for green peas.

8 0
3 years ago
PLEASE HELP ASAP <br><br> 1. What do you think the DNA on a banana will look like?
Gekata [30.6K]

Answer:

Nothing you won't be able to see it. It is too small.

Explanation:

6 0
3 years ago
Why have lions adapted to have sharper teeth than cows
statuscvo [17]

Answer:

Lions need to blend in their surrounding, but cows don't. ... What adaptation helps a camel to survive in the desert?

Explanation:

8 0
3 years ago
[O.05]Read the paragraph below.
liubo4ka [24]

Answer: geosphere and biosphere

Explanation:

The geosphere is the part of the earth which lies below the earth crust. The biosphere is the sphere where all living beings survive.

According to the given situation, the ocean is interacting with the geosphere and biosphere. This is because of the fact that the earthquake emerged in the undersurface of the ocean is the part of the geosphere. The waves produced due to instability of the undersurface resulted in high speed waves. These waves resulted in drastic floods. The floods caused the destruction of the property of the coast, inland areas, plants and animals which came in contact with the flood. Hence, the biosphere was affected.

8 0
3 years ago
what uses symbols to quickly express ideas? A.image formation B. sensory experience C. mental concepts D. language
alukav5142 [94]
The symbols to quickly express ideas is A image

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which situation describes mutualism?
    15·2 answers
  • Which of the following best describes the interaction between Earth’s crust and living organisms?
    8·2 answers
  • The process of actual separation of cells at the end of mitosis is called _____. metaphase cytokinesis interphase anaphase
    5·2 answers
  • A man who donates sperm to a sperm bank is maximizing his __________________ while minimizing his _____________. By shopping thr
    8·2 answers
  • Which are the physical (P), chemical (C), and biological (B) immune responses?
    11·1 answer
  • The basic unit of all forms of life is a(n)
    13·2 answers
  • How are the mutations in a genome similar to printing a book?
    14·1 answer
  • Which process moves water molecules across the membrane of a cell?
    11·2 answers
  • Small rocks carried along by the river are called?
    10·1 answer
  • Write a paragraph about the camouflaging adaptation of KATYDIDS (insects) to be safe during day time
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!