Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, t
hat codes for an 8 amino-acid peptide (assume traditional start codon). Transcription of PICO8 starts at the Transcription Start Site (TSS) after the promoter and proceeds in the direction of the arrow. Transcription stops at the end of the transcription terminator. 5' - CTATAAAGAGCCATGCATATCTAGATAGTAGGCTCTGAGAATTTATCTCACT - 3
3 - GATATTTCTCGGTACGTATAGATCTATCATCCGAGACTCTTAA ATAGAGTGA - 5
promoter terminator
Which strand of DNA is the CODING strand? (TOP OF BOTTOM?) Select only ONE answer choice.
A. Top
B. Bottom
C. Either can serve as the codong strand
D. There isn't enough information to determine which is the coding strand
D. There isn't enough information to determine which is the coding strand
Explanation:
In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.
Poverty is the root of all evil in this situation along with gendder discrimination. Because of the social unpopularity regarding females and because many women lie below standard income, they simply cant afford or just refuse to have kids.
Stem cells of the animals are the most similar to the meristematic cells of the plant.
<u>Explanation:</u>
Meristematic cells are the most important cells for the plant which give rise to the various tissues and plant organs. These meristematic cells are capable to undergo cell division and they are called totipotent.
The stem cells of animals and humans are capable of doing the function by replacing the new cells for growth and development.
The difference among these two tissues is that meristematic is capable to produce total organs whereas stem cells are capable to produce only specific tissues.
