1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paul [167]
3 years ago
10

Sedimentary rocks are formed due to the

Biology
2 answers:
Margarita [4]3 years ago
8 0

Answer:

weathering of rocks

Explanation:

andrezito [222]3 years ago
4 0

Answer:

Changes in pressure

Explanation:

Sedentary rocks are rocks that are often found in hillsides or creeks that have washed away surrounding sediment.

You might be interested in
Which method provides the most accurate evidence for scientists to use when determining evolutionary relationships between two s
Temka [501]
Comparing genetic sequences is the most accurate way of determining evolutionary relationships. This is a quantitive measure, ( it uses numbers) we can use gene sequencing to identify how much of the genetic sequence in A is the same in organism B. The greater the similarities the more likely it is they have recently evolved from a common ancestor. The closer the ancestor, the less time has passed which means there’s been less time to develop mutations a base variation. That’s why there’s more genetic similarities between two things that are closely related.
Hope that makes sense
8 0
2 years ago
Compare and contrast white meat and dark meat in poultry.
KATRIN_1 [288]

White meat are usually found at the breast and wings while dark meat are found at the legs of the chicken.

<h3>What are types of poultry?</h3>

Poultry is the type of meat that is gotten from birds such as the Muscovy ducks, mallard ducks, turkeys, guinea fowl, geese, quail, pigeons, ostriches and pheasants.

Poultry meat provides the body with the following nutrients:

  • protein,

  • thiamin,

  • riboflavin,

  • niacin,

  • pyridoxine,

  • vitamin E,

  • zinc,

  • iron, and magnesium.

There are different type of poultry meat which include:

  • White poultry meat and

  • Dark poultry meat.

The white poultry meat are located at the breast and wings of the chicken and are known to contain 10% red fibres.

The dark poultry meat are located at the legs of the chicken and are known to contain 50% red fibres.

Therefore, although both white and dark poultry meat can be found in a bird, they are quite different because they contain different quantity of red fibres.

Learn more about meat here:

brainly.com/question/28074641

#SPJ1

3 0
2 years ago
The dna of what floats freely around the cells cytoplasm
Alona [7]
The protoplasm of a cell
4 0
4 years ago
A cystocentesis is a answer.....Cystocentesis is a veterinary procedure where a needle is placed into the urinary bladder throug
Phoenix [80]
<span>A veterinary procedure where a needle is injected into the bladder of an animal through the abdominal wall. A sample of urine is then removed.

Hope that helps! </span>
3 0
3 years ago
How will a wind blowing to the south in the Northern Hemisphere be affected
____ [38]

Answer:

The answer is C: It will blend to the East

Explanation:

The Coriolis effect makes storms swirl clockwise in the Southern hemisphere and counterclockwise in the Northern Hemisphere.

The Coriolis effect influences wind direction around the world in this way: in the Northern Hemisphere it curves winds to the right; in the Southern Hemisphere it curves them left. … In these systems there is a balance between the Coriolis effect and the pressure gradient force and the winds flow in reverse

4 0
2 years ago
Other questions:
  • Which of the following foods would have the both fat and protein?
    15·1 answer
  • Could someone please help me with this answer thank you!
    15·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • The flow of information within a neuron is ________, whereas the flow of information between neurons is ________.
    6·1 answer
  • What is ab imprtant function of this cell protien channel in the plasma membrane?
    11·1 answer
  • With regard to enzymes key is to lock as
    6·1 answer
  • What substance can move across a barrier by osmosis? Give the name ​
    7·2 answers
  • Please help quickly thanks
    12·2 answers
  • When a slingshot is held in the position shown in the diagram, what kind<br> of energy is present?
    11·1 answer
  • Match the Macromolecule with its corresponding monomer. Carbohydrate Lipid Il Protein Nucleic Acid :: Glucose :: Fatty Acid :: A
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!