1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qwelly [4]
3 years ago
15

I don’t know the answer to this questions please help

Biology
1 answer:
Ahat [919]3 years ago
5 0

Answer:

Explanation:

It would be the wheels because it is the moving part of the cell.

You might be interested in
Where in the cell does glucose end up? Why
Elina [12.6K]

Answer:

In stage one, glucose is broken down in the cytoplasm of the cell in a process called glycolysis. In stage two, the pyruvate molecules are transported into the mitochondria. The mitochondria are the organelles known as the energy "powerhouses" of the cells

4 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Can someone explain eukaryotic cells and prokaryotic cells like you’re talking to a 5 year old?
Fed [463]

Eukaryotic cells do not have a nucleus. The nucleus is where DNA, your genetic material, is usually stored. Prokaryotic cells do not have a nucleus. The DNA just floats around the cell instead of staying in one designated area.

6 0
2 years ago
The body system that defends against infection and disease is called
aev [14]
Your immune system fights of disease
7 0
3 years ago
Read 2 more answers
1. What processes that occur during meiosis contribute to
andrey2020 [161]
A and D because cytokinesis is where a single eukaryotic cell divides into two daughter cells. Gametogenesis is the name given to the process where the cell undergoes meiosis.
8 0
1 year ago
Other questions:
  • Organisms use what to work, grow, and change?
    9·2 answers
  • How do you do this?‍♀️
    13·1 answer
  • Explain how the nervous system helps the muscular system control heart rete, digestion, and respiration
    7·1 answer
  • Blood type is an example of codominance, where blood type a is dominant with blood type b, and blood type o is considered recess
    10·1 answer
  • Define aggumulation in biology​
    8·2 answers
  • ASAP What is the main negative effect of slash and burn deforestation in rain forests?
    14·1 answer
  • In the chemical equation for photosynthesis, carbon dioxide and water are converted to glucose and oxygen
    6·1 answer
  • All living organisms break down sugar to obtain energy using cellular respiration, Which of the following chemical reactions rep
    7·1 answer
  • What does Greenberg identify as being a terrible problem, and how do we fix it?
    9·1 answer
  • If you pass a magnet through a wire loop you can
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!