1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qwelly [4]
3 years ago
15

I don’t know the answer to this questions please help

Biology
1 answer:
Ahat [919]3 years ago
5 0

Answer:

Explanation:

It would be the wheels because it is the moving part of the cell.

You might be interested in
Your dog licked the last of your spaghetti off your plate. Why might you wash it in bleach water? (Remember to refer to bacteria
Stolb23 [73]

Answer:because bacteria could multiply and spread dogs carry whatever knows what in there mouths cleaning the plate is just common sense

Explanation:

4 0
3 years ago
Read 2 more answers
Why doesn’t it seem as if the geosphere ever changes?
Scorpion4ik [409]
<span>This is because changes on the planet are slow and take long periods of time (geological times) for observable changes to be noticed by humans. While the earth looks static, it is dynamic and can be shown by a time-lapse camera put in a location such as a tectonic boundary</span>




7 0
3 years ago
Read 2 more answers
Need help someone knows the answer
Mariulka [41]

Answer:

d. landfill materials

Explanation:

4 0
3 years ago
Read 2 more answers
What is a plateau and how can one form??
dusya [7]
The up welling of volcanic magma. This also make the flat rock be uplifted in to the plateau
5 0
4 years ago
Sunlight, carbon dioxide, and water are required for photosynthesis. Examine the graph. What is the best explanation for the rel
Blizzard [7]

Answer:

B

Explanation:making things with light”. Photosynthesis takes place inside capsules in the leaf cells, called CHLOROPLASTS.

3 0
4 years ago
Read 2 more answers
Other questions:
  • Social cognitive theory proposes that changing a behavior is a function of individual characteristics. True or False
    12·1 answer
  • what is a classify a pet dog as a autotrophy or heterotroph and as an herbivore carnivore, or omnivore
    10·1 answer
  • What function do the alveolar sacs serve in the respiratory system
    8·1 answer
  • If the lift was greater than the weight of the plane the plane would
    11·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • If bears find insects after they move decaying logs, they more frequently move decaying logs. This most clearly indicates that f
    9·1 answer
  • What kind of molecule is the "adapter" that couples amino acid sequences to the sequence of bases in the mrna? see section 17?
    12·1 answer
  • Match the following groups to their descriptions:
    5·1 answer
  • Multigene families are Multigene families are groups of enhancers that control transcription. sets of genes that are coordinatel
    5·1 answer
  • In which of the following ways are DNA and mRNA different?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!