1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MakcuM [25]
3 years ago
12

What is the most superior upper body muscle?

Biology
2 answers:
Vlad1618 [11]3 years ago
8 0
Obturator Externus

Obturator Externus: This is one of the smaller muscles of the medial thigh, and it is located most superiorly.
Vinvika [58]3 years ago
4 0

Answer:

Obturator Externus

Obturator Externus: This is one of the smaller muscles of the medial thigh, and it is located most superiorly.

Explanation:

You might be interested in
Which of the following describes the ability of a single allele to influence more than one trait? a. polygenic inheritance b. mu
Anna71 [15]

Answer:

yes b

Explanation:

8 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
What is the boundary between the earths lower mantle and the upper mantle called ?
Alenkasestr [34]

Answer:

i have trusted my best to answer

Explanation:

Edit

The upper mantle of Earth is a very thick layer of rock inside the planet, which begins just beneath the crust (at about 10 km (6.2 mi) under the oceans and about 35 km (22 mi) under the continents) and ends at the top of the lower mantle at 670 km (420 mi). Temperatures range from approximately 200 °C (392 °F) at the upper boundary with the crust to approximately 900 °C (1,650 °F) at the boundary with the lower mantle. Upper mantle material which has come up onto the surface is made up of about 55% olivine, 35% pyroxene and 5 to 10% of calcium oxide and aluminum oxide minerals such as plagioclase, spinel, or garnet, depending upon depth.

5 0
3 years ago
Some strains of Mycobacterium tuberculosis are resistant to so many antibiotics that it has become known as a(n)
timama [110]

Answer:

\huge\boxed{\sf Multidrug\ resistant}

Explanation:

<u>Antibiotics:</u>

"Medicines used against bacteria are called antibiotics."

<u>Example:</u>

Rifampin, isoniazid.

Mycobacterium Tuberculosis is a bacteria.

However, some of its strains are resistant to antibiotics and thus is classified as multidrug resistant (MDR resistant)

\rule[225]{225}{2}

Hope this helped!

<h3>~AH1807</h3>

3 0
2 years ago
In North America, the eastern spotted skunk mates
Setler [38]
The answer is gonna be B
7 0
3 years ago
Other questions:
  • Ou are treating a patient who was stabbed in the right side of the anterior chest wall. he has shortness of​ breath, weakness, a
    10·1 answer
  • An insect is able to walk across the suurface of the oond without sinking because of the
    12·2 answers
  • Use the data in the following to calculate the number of half lives that have passed since the granite
    14·1 answer
  • How have the governments of the Romans and Greeks influenced our modern Western governments?
    8·1 answer
  • Biology answers many questions, but its main focus is...
    11·2 answers
  • What term defines a gene made up of two different alleles
    6·2 answers
  • Select all the correct answers.
    14·2 answers
  • Which organelles make up plant cells? pls i need help i have a aassignment due in 1 hr
    13·1 answer
  • You are sitting in a room with a door on your lef
    8·2 answers
  • A class of lipids used as chemical messengers, to signal cells to undergo changes, is called triglycerides. phospholipids. polys
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!