I believe A translates to U, T transtates to A, G translates to C, and C traslates to G.
<span> ATGCGCTGCACGTGCACGTTTACGCGACGTGCACGTGCAA
</span>
mRNA
UACGCGACGUGCACGUGCAAAUGCGCUGCACGUGCACGUU
The mesosphere extends upward above the stratosphere, temperatures decrease. The coldest parts of our atmosphere are located in this layer and can reach –90°C.
<span>Because of semi-conservative replication in DNA synthesis, One of the strands of the new DNA molecule is original and one of the strands of the molecule is composed of new nucleic acids.</span>
Answer:
150 AA, 300 Aa and 150 aa
Explanation:
<u>The expected phenotypic ratio of 1:2:1 means that we expect:</u>
- 1/4 of the offspring to be AA
- 2/4 of the offspring to be Aa
- 1/4 of the offspring to be aa
<u>If the total number of offspring was 600, then the E values would be:</u>
Answer:
Carley has become operantly conditioned.
Explanation:
Operant conditioning can be described as a method of learning which focuses on the rewards or punishments that will be given in course for an action. As Carley has learned that whenever she wants a rush of natural adrenaline, she needs to swim forty laps in the pool, she considers it to be a reward. Such type of practices behaviour demonstrates operant conditioning.